Incidental Mutation 'R5226:Oxgr1'
ID 402633
Institutional Source Beutler Lab
Gene Symbol Oxgr1
Ensembl Gene ENSMUSG00000044819
Gene Name oxoglutarate (alpha-ketoglutarate) receptor 1
Synonyms LOC239283, Gpr99, P2Y15, Cysltr3, Gpr80
MMRRC Submission 042799-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5226 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 120019585-120042435 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120022253 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 181 (S181P)
Ref Sequence ENSEMBL: ENSMUSP00000055137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058213]
AlphaFold Q6IYF8
Predicted Effect probably damaging
Transcript: ENSMUST00000058213
AA Change: S181P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055137
Gene: ENSMUSG00000044819
AA Change: S181P

DomainStartEndE-ValueType
Pfam:7tm_1 50 302 3.8e-35 PFAM
Meta Mutation Damage Score 0.2756 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor (GPCR) that belongs to the oxoglutarate receptor family within the GPCR superfamily. The encoded protein is activated by the citric acid intermediate, oxoglutarate, as well as several cysteinyl leukotrienes, including leukotrienes E4, C4 and D4, which are implicated in many inflammatory disorders. In mice, a knock-out of this gene leads to middle ear inflammation, changes in the mucosal epithelium, and an increase in fluid behind the eardrum, and is associated with hearing loss. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced leukotriene E4 ligand (LTE4)-induced ear edema at low and intermediate doses and abnormal acid-base balance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,294,076 K98E possibly damaging Het
4933414I15Rik A T 11: 50,942,589 M62K unknown Het
Akr1d1 T A 6: 37,536,014 probably null Het
Ankrd63 T C 2: 118,703,255 probably benign Het
Atad5 T C 11: 80,095,062 V325A probably damaging Het
Atp13a5 G T 16: 29,248,279 N1025K probably damaging Het
Atrnl1 G T 19: 57,650,335 V302L probably benign Het
Bend7 C A 2: 4,752,978 S277* probably null Het
Btnl7-ps A T 17: 34,533,287 noncoding transcript Het
Cbx4 T C 11: 119,081,928 Y207C probably damaging Het
Ctla2b C T 13: 60,896,332 W63* probably null Het
Cux1 T C 5: 136,370,173 T170A probably benign Het
Cyp3a57 T C 5: 145,365,697 V101A probably benign Het
Dao A T 5: 114,021,033 T267S probably benign Het
Dsp A G 13: 38,186,770 D883G probably damaging Het
Eif4g3 C A 4: 138,096,794 P36T possibly damaging Het
Elf3 G A 1: 135,257,239 L70F probably benign Het
Epb41l4a C T 18: 33,810,313 D510N probably damaging Het
Gcn1l1 T C 5: 115,588,067 S594P probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gpr132 T C 12: 112,852,148 T353A probably benign Het
Kntc1 A G 5: 123,794,172 D1343G probably benign Het
L3mbtl4 T A 17: 68,764,722 probably null Het
Lrit2 A G 14: 37,072,353 E458G probably damaging Het
Man1c1 A T 4: 134,578,369 I348N probably damaging Het
Map4k2 A G 19: 6,346,504 probably benign Het
Nt5c2 A C 19: 46,898,629 Y203D probably damaging Het
Parn A G 16: 13,625,552 C400R probably benign Het
Pcdhgb7 T C 18: 37,752,524 V249A probably benign Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Plcg2 A T 8: 117,577,874 I273F possibly damaging Het
Plin1 A G 7: 79,722,699 V64A probably damaging Het
Ppfia4 C A 1: 134,304,286 probably null Het
Prkg2 A C 5: 98,976,462 D376E possibly damaging Het
Ptgir T A 7: 16,908,720 I82N probably damaging Het
Pum2 C T 12: 8,713,458 P205L possibly damaging Het
Rab26 T A 17: 24,534,133 probably benign Het
Recql4 T C 15: 76,710,129 E63G probably benign Het
Rora T A 9: 69,364,141 probably benign Het
Rp1 A C 1: 4,348,033 M952R probably benign Het
Rpap3 T A 15: 97,703,223 R44S possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc12a2 C A 18: 57,879,020 P72T probably damaging Het
Slc1a3 C T 15: 8,642,225 V416M probably damaging Het
Slfn4 A T 11: 83,187,549 M388L possibly damaging Het
Snrnp48 G A 13: 38,205,117 A49T probably benign Het
Tctex1d4 A G 4: 117,128,093 T38A possibly damaging Het
Tlx2 C T 6: 83,068,930 G228D possibly damaging Het
Tmem132a A G 19: 10,867,144 V30A possibly damaging Het
Tnfrsf23 C A 7: 143,685,785 L24F possibly damaging Het
Ubr2 A T 17: 46,983,270 N312K probably benign Het
Vmn1r115 C T 7: 20,844,244 V248I probably damaging Het
Vmn2r80 A G 10: 79,194,040 T567A probably benign Het
Vps13c A G 9: 67,945,553 T2372A probably benign Het
Wnt10b G T 15: 98,776,614 H81N probably damaging Het
Zfp948 A G 17: 21,588,243 T566A probably benign Het
Other mutations in Oxgr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02167:Oxgr1 APN 14 120021930 missense probably damaging 0.97
IGL02678:Oxgr1 APN 14 120022168 missense probably damaging 1.00
IGL03387:Oxgr1 APN 14 120022787 nonsense probably null
IGL03394:Oxgr1 APN 14 120022610 missense possibly damaging 0.65
R1615:Oxgr1 UTSW 14 120022773 missense probably benign 0.25
R2919:Oxgr1 UTSW 14 120022809 start gained probably benign
R4223:Oxgr1 UTSW 14 120022613 missense probably damaging 1.00
R4409:Oxgr1 UTSW 14 120022160 missense possibly damaging 0.67
R4783:Oxgr1 UTSW 14 120022364 missense probably benign
R5213:Oxgr1 UTSW 14 120022140 nonsense probably null
R6416:Oxgr1 UTSW 14 120022448 missense probably damaging 0.99
R6491:Oxgr1 UTSW 14 120022007 missense probably benign 0.01
R6670:Oxgr1 UTSW 14 120022257 missense probably damaging 1.00
R6904:Oxgr1 UTSW 14 120022019 missense possibly damaging 0.90
R7089:Oxgr1 UTSW 14 120022202 missense probably damaging 1.00
R7819:Oxgr1 UTSW 14 120022869 critical splice acceptor site probably null
R9672:Oxgr1 UTSW 14 120022042 missense probably damaging 1.00
R9731:Oxgr1 UTSW 14 120022682 missense probably benign 0.00
R9803:Oxgr1 UTSW 14 120022151 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GCTTAAAGCAGCTGTGGGTC -3'
(R):5'- ATTTCATGTGCAAGTTCATCCGC -3'

Sequencing Primer
(F):5'- CAGCTGTGGGTCCGAGG -3'
(R):5'- TTCAACCTCTACAGCAGCATTC -3'
Posted On 2016-07-22