Incidental Mutation 'R5226:Slc1a3'
ID402634
Institutional Source Beutler Lab
Gene Symbol Slc1a3
Ensembl Gene ENSMUSG00000005360
Gene Namesolute carrier family 1 (glial high affinity glutamate transporter), member 3
SynonymsGLAST, MGluT1, Gmt1, B430115D02Rik, Eaat1
MMRRC Submission 042799-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5226 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location8634124-8710764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 8642225 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 416 (V416M)
Ref Sequence ENSEMBL: ENSMUSP00000005493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005493]
Predicted Effect probably damaging
Transcript: ENSMUST00000005493
AA Change: V416M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005493
Gene: ENSMUSG00000005360
AA Change: V416M

DomainStartEndE-ValueType
Pfam:SDF 50 497 8.5e-135 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128879
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a member of a high affinity glutamate transporter family. This gene functions in the termination of excitatory neurotransmission in central nervous system. Mutations are associated with episodic ataxia, Type 6. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene display no abnormalities with respect to appearance or survival but do display functional abnormalities related to the central nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,294,076 K98E possibly damaging Het
4933414I15Rik A T 11: 50,942,589 M62K unknown Het
Akr1d1 T A 6: 37,536,014 probably null Het
Ankrd63 T C 2: 118,703,255 probably benign Het
Atad5 T C 11: 80,095,062 V325A probably damaging Het
Atp13a5 G T 16: 29,248,279 N1025K probably damaging Het
Atrnl1 G T 19: 57,650,335 V302L probably benign Het
Bend7 C A 2: 4,752,978 S277* probably null Het
Btnl7-ps A T 17: 34,533,287 noncoding transcript Het
Cbx4 T C 11: 119,081,928 Y207C probably damaging Het
Ctla2b C T 13: 60,896,332 W63* probably null Het
Cux1 T C 5: 136,370,173 T170A probably benign Het
Cyp3a57 T C 5: 145,365,697 V101A probably benign Het
Dao A T 5: 114,021,033 T267S probably benign Het
Dsp A G 13: 38,186,770 D883G probably damaging Het
Eif4g3 C A 4: 138,096,794 P36T possibly damaging Het
Elf3 G A 1: 135,257,239 L70F probably benign Het
Epb41l4a C T 18: 33,810,313 D510N probably damaging Het
Gcn1l1 T C 5: 115,588,067 S594P probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gpr132 T C 12: 112,852,148 T353A probably benign Het
Kntc1 A G 5: 123,794,172 D1343G probably benign Het
L3mbtl4 T A 17: 68,764,722 probably null Het
Lrit2 A G 14: 37,072,353 E458G probably damaging Het
Man1c1 A T 4: 134,578,369 I348N probably damaging Het
Map4k2 A G 19: 6,346,504 probably benign Het
Nt5c2 A C 19: 46,898,629 Y203D probably damaging Het
Oxgr1 A G 14: 120,022,253 S181P probably damaging Het
Parn A G 16: 13,625,552 C400R probably benign Het
Pcdhgb7 T C 18: 37,752,524 V249A probably benign Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Plcg2 A T 8: 117,577,874 I273F possibly damaging Het
Plin1 A G 7: 79,722,699 V64A probably damaging Het
Ppfia4 C A 1: 134,304,286 probably null Het
Prkg2 A C 5: 98,976,462 D376E possibly damaging Het
Ptgir T A 7: 16,908,720 I82N probably damaging Het
Pum2 C T 12: 8,713,458 P205L possibly damaging Het
Rab26 T A 17: 24,534,133 probably benign Het
Recql4 T C 15: 76,710,129 E63G probably benign Het
Rora T A 9: 69,364,141 probably benign Het
Rp1 A C 1: 4,348,033 M952R probably benign Het
Rpap3 T A 15: 97,703,223 R44S possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc12a2 C A 18: 57,879,020 P72T probably damaging Het
Slfn4 A T 11: 83,187,549 M388L possibly damaging Het
Snrnp48 G A 13: 38,205,117 A49T probably benign Het
Tctex1d4 A G 4: 117,128,093 T38A possibly damaging Het
Tlx2 C T 6: 83,068,930 G228D possibly damaging Het
Tmem132a A G 19: 10,867,144 V30A possibly damaging Het
Tnfrsf23 C A 7: 143,685,785 L24F possibly damaging Het
Ubr2 A T 17: 46,983,270 N312K probably benign Het
Vmn1r115 C T 7: 20,844,244 V248I probably damaging Het
Vmn2r80 A G 10: 79,194,040 T567A probably benign Het
Vps13c A G 9: 67,945,553 T2372A probably benign Het
Wnt10b G T 15: 98,776,614 H81N probably damaging Het
Zfp948 A G 17: 21,588,243 T566A probably benign Het
Other mutations in Slc1a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Slc1a3 APN 15 8645687 missense probably damaging 1.00
IGL01133:Slc1a3 APN 15 8650993 missense probably damaging 1.00
IGL01696:Slc1a3 APN 15 8642338 missense probably benign 0.19
IGL03108:Slc1a3 APN 15 8639078 missense probably damaging 1.00
R0128:Slc1a3 UTSW 15 8636209 missense probably benign 0.07
R0206:Slc1a3 UTSW 15 8708556 splice site probably benign
R0312:Slc1a3 UTSW 15 8636237 missense probably benign 0.00
R0385:Slc1a3 UTSW 15 8639135 missense probably damaging 1.00
R0538:Slc1a3 UTSW 15 8650922 missense probably benign
R0579:Slc1a3 UTSW 15 8688309 missense probably damaging 0.98
R1799:Slc1a3 UTSW 15 8688404 missense probably damaging 1.00
R2029:Slc1a3 UTSW 15 8645669 missense probably benign 0.29
R3236:Slc1a3 UTSW 15 8639123 missense probably damaging 0.98
R4494:Slc1a3 UTSW 15 8639095 missense probably damaging 1.00
R5010:Slc1a3 UTSW 15 8650846 splice site probably benign
R5154:Slc1a3 UTSW 15 8642949 missense probably benign 0.09
R5538:Slc1a3 UTSW 15 8645704 missense probably damaging 0.99
R6049:Slc1a3 UTSW 15 8645693 missense probably damaging 1.00
R6072:Slc1a3 UTSW 15 8708568 missense probably damaging 0.99
R6496:Slc1a3 UTSW 15 8649581 missense probably benign 0.01
R7015:Slc1a3 UTSW 15 8649568 missense probably damaging 1.00
R7168:Slc1a3 UTSW 15 8645902 missense possibly damaging 0.79
R7255:Slc1a3 UTSW 15 8642999 missense possibly damaging 0.90
R7476:Slc1a3 UTSW 15 8643084 missense probably damaging 0.99
R7732:Slc1a3 UTSW 15 8650988 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GGAACACAATGGCTCCCTAATC -3'
(R):5'- TCTGTGCCAAAGAGCAAAGAC -3'

Sequencing Primer
(F):5'- AATGGCTCCCTAATCTCCTATTTATG -3'
(R):5'- AGCTGACATGCCCTGTTTTG -3'
Posted On2016-07-22