Incidental Mutation 'R5226:Recql4'
ID402635
Institutional Source Beutler Lab
Gene Symbol Recql4
Ensembl Gene ENSMUSG00000033762
Gene NameRecQ protein-like 4
Synonyms
MMRRC Submission 042799-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5226 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76703553-76710548 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76710129 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 63 (E63G)
Ref Sequence ENSEMBL: ENSMUSP00000154957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036423] [ENSMUST00000036852] [ENSMUST00000127208] [ENSMUST00000136840] [ENSMUST00000137649] [ENSMUST00000142610] [ENSMUST00000155225] [ENSMUST00000155735] [ENSMUST00000230544] [ENSMUST00000230724]
Predicted Effect probably benign
Transcript: ENSMUST00000036423
SMART Domains Protein: ENSMUSP00000049466
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036852
AA Change: E63G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044363
Gene: ENSMUSG00000033762
AA Change: E63G

DomainStartEndE-ValueType
Pfam:Drc1-Sld2 4 132 2.8e-14 PFAM
low complexity region 169 187 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
ZnF_C2HC 394 410 5.67e-5 SMART
DEXDc 494 701 5.86e-28 SMART
HELICc 736 831 1.48e-24 SMART
Blast:DEXDc 902 1117 3e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127208
SMART Domains Protein: ENSMUSP00000114921
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136840
SMART Domains Protein: ENSMUSP00000119670
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137649
SMART Domains Protein: ENSMUSP00000121982
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142506
Predicted Effect probably benign
Transcript: ENSMUST00000142610
SMART Domains Protein: ENSMUSP00000117780
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154531
Predicted Effect probably benign
Transcript: ENSMUST00000155225
Predicted Effect probably benign
Transcript: ENSMUST00000155735
SMART Domains Protein: ENSMUSP00000115446
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229360
Predicted Effect probably benign
Transcript: ENSMUST00000230544
Predicted Effect probably benign
Transcript: ENSMUST00000230724
AA Change: E63G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0868 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA helicase that belongs to the RecQ helicase family. DNA helicases unwind double-stranded DNA into single-stranded DNAs and may modulate chromosome segregation. This gene is predominantly expressed in thymus and testis. Mutations in this gene are associated with Rothmund-Thomson, RAPADILINO and Baller-Gerold syndromes. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous loss of exons 5-8 causes embryonic death. Deletion of exon 13 causes neo- and postnatal lethality, stunted growth, skin, hair and bone defects, tissue hypoplasia and tooth dysgenesis. Mice lacking exons 9-13 show palate and limb defects, aneuploidy, poikiloderma and cancer predisposition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,294,076 K98E possibly damaging Het
4933414I15Rik A T 11: 50,942,589 M62K unknown Het
Akr1d1 T A 6: 37,536,014 probably null Het
Ankrd63 T C 2: 118,703,255 probably benign Het
Atad5 T C 11: 80,095,062 V325A probably damaging Het
Atp13a5 G T 16: 29,248,279 N1025K probably damaging Het
Atrnl1 G T 19: 57,650,335 V302L probably benign Het
Bend7 C A 2: 4,752,978 S277* probably null Het
Btnl7-ps A T 17: 34,533,287 noncoding transcript Het
Cbx4 T C 11: 119,081,928 Y207C probably damaging Het
Ctla2b C T 13: 60,896,332 W63* probably null Het
Cux1 T C 5: 136,370,173 T170A probably benign Het
Cyp3a57 T C 5: 145,365,697 V101A probably benign Het
Dao A T 5: 114,021,033 T267S probably benign Het
Dsp A G 13: 38,186,770 D883G probably damaging Het
Eif4g3 C A 4: 138,096,794 P36T possibly damaging Het
Elf3 G A 1: 135,257,239 L70F probably benign Het
Epb41l4a C T 18: 33,810,313 D510N probably damaging Het
Gcn1l1 T C 5: 115,588,067 S594P probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gpr132 T C 12: 112,852,148 T353A probably benign Het
Kntc1 A G 5: 123,794,172 D1343G probably benign Het
L3mbtl4 T A 17: 68,764,722 probably null Het
Lrit2 A G 14: 37,072,353 E458G probably damaging Het
Man1c1 A T 4: 134,578,369 I348N probably damaging Het
Map4k2 A G 19: 6,346,504 probably benign Het
Nt5c2 A C 19: 46,898,629 Y203D probably damaging Het
Oxgr1 A G 14: 120,022,253 S181P probably damaging Het
Parn A G 16: 13,625,552 C400R probably benign Het
Pcdhgb7 T C 18: 37,752,524 V249A probably benign Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Plcg2 A T 8: 117,577,874 I273F possibly damaging Het
Plin1 A G 7: 79,722,699 V64A probably damaging Het
Ppfia4 C A 1: 134,304,286 probably null Het
Prkg2 A C 5: 98,976,462 D376E possibly damaging Het
Ptgir T A 7: 16,908,720 I82N probably damaging Het
Pum2 C T 12: 8,713,458 P205L possibly damaging Het
Rab26 T A 17: 24,534,133 probably benign Het
Rora T A 9: 69,364,141 probably benign Het
Rp1 A C 1: 4,348,033 M952R probably benign Het
Rpap3 T A 15: 97,703,223 R44S possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc12a2 C A 18: 57,879,020 P72T probably damaging Het
Slc1a3 C T 15: 8,642,225 V416M probably damaging Het
Slfn4 A T 11: 83,187,549 M388L possibly damaging Het
Snrnp48 G A 13: 38,205,117 A49T probably benign Het
Tctex1d4 A G 4: 117,128,093 T38A possibly damaging Het
Tlx2 C T 6: 83,068,930 G228D possibly damaging Het
Tmem132a A G 19: 10,867,144 V30A possibly damaging Het
Tnfrsf23 C A 7: 143,685,785 L24F possibly damaging Het
Ubr2 A T 17: 46,983,270 N312K probably benign Het
Vmn1r115 C T 7: 20,844,244 V248I probably damaging Het
Vmn2r80 A G 10: 79,194,040 T567A probably benign Het
Vps13c A G 9: 67,945,553 T2372A probably benign Het
Wnt10b G T 15: 98,776,614 H81N probably damaging Het
Zfp948 A G 17: 21,588,243 T566A probably benign Het
Other mutations in Recql4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Recql4 APN 15 76707336 missense possibly damaging 0.52
IGL01287:Recql4 APN 15 76709912 splice site probably benign
IGL01470:Recql4 APN 15 76708944 missense probably benign 0.40
IGL01809:Recql4 APN 15 76708870 nonsense probably null
IGL02094:Recql4 APN 15 76709517 missense probably benign 0.01
IGL02303:Recql4 APN 15 76708571 missense possibly damaging 0.64
IGL02702:Recql4 APN 15 76707285 missense probably damaging 1.00
IGL03086:Recql4 APN 15 76706268 missense probably benign 0.30
IGL03162:Recql4 APN 15 76706096 splice site probably null
ANU74:Recql4 UTSW 15 76705757 missense possibly damaging 0.47
F5770:Recql4 UTSW 15 76706169 missense possibly damaging 0.79
R0688:Recql4 UTSW 15 76709809 unclassified probably null
R1171:Recql4 UTSW 15 76704039 missense possibly damaging 0.94
R1348:Recql4 UTSW 15 76709211 missense probably benign 0.01
R1487:Recql4 UTSW 15 76708983 missense probably benign 0.11
R1547:Recql4 UTSW 15 76706311 missense probably damaging 0.99
R1917:Recql4 UTSW 15 76703837 nonsense probably null
R3813:Recql4 UTSW 15 76704494 missense possibly damaging 0.67
R4066:Recql4 UTSW 15 76705827 missense probably damaging 1.00
R4363:Recql4 UTSW 15 76706044 missense probably benign 0.07
R4387:Recql4 UTSW 15 76705958 missense probably benign 0.00
R4388:Recql4 UTSW 15 76705958 missense probably benign 0.00
R4700:Recql4 UTSW 15 76708585 missense probably damaging 1.00
R4701:Recql4 UTSW 15 76708585 missense probably damaging 1.00
R4923:Recql4 UTSW 15 76710181 missense probably damaging 1.00
R5075:Recql4 UTSW 15 76709544 missense probably damaging 1.00
R5103:Recql4 UTSW 15 76706756 missense probably damaging 1.00
R5500:Recql4 UTSW 15 76705578 intron probably benign
R5547:Recql4 UTSW 15 76705794 nonsense probably null
R5824:Recql4 UTSW 15 76708585 missense probably damaging 1.00
R5976:Recql4 UTSW 15 76709424 missense probably benign 0.01
R6086:Recql4 UTSW 15 76704587 missense probably damaging 0.96
R6756:Recql4 UTSW 15 76704859 missense probably benign 0.00
R7075:Recql4 UTSW 15 76706424 missense possibly damaging 0.95
R7086:Recql4 UTSW 15 76705553 missense unknown
R7449:Recql4 UTSW 15 76705565 missense unknown
R7653:Recql4 UTSW 15 76703782 missense probably benign 0.01
V7580:Recql4 UTSW 15 76706169 missense possibly damaging 0.79
V7581:Recql4 UTSW 15 76706169 missense possibly damaging 0.79
V7583:Recql4 UTSW 15 76706169 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CCTAGACCAGTTTAAAAGATGGC -3'
(R):5'- ACAAGCTTCTCTCCTAGGGG -3'

Sequencing Primer
(F):5'- CCAGTTTAAAAGATGGCATGGGC -3'
(R):5'- AGCTTCTCTCCTAGGGGGATGTG -3'
Posted On2016-07-22