Incidental Mutation 'R5226:Wnt10b'
ID402637
Institutional Source Beutler Lab
Gene Symbol Wnt10b
Ensembl Gene ENSMUSG00000022996
Gene Namewingless-type MMTV integration site family, member 10B
SynonymsWnt12
MMRRC Submission 042799-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5226 (G1)
Quality Score114
Status Validated
Chromosome15
Chromosomal Location98770712-98778150 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 98776614 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 81 (H81N)
Ref Sequence ENSEMBL: ENSMUSP00000154384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023732] [ENSMUST00000166022] [ENSMUST00000226610] [ENSMUST00000226655] [ENSMUST00000226846] [ENSMUST00000228546] [ENSMUST00000228594]
Predicted Effect probably damaging
Transcript: ENSMUST00000023732
AA Change: H81N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023732
Gene: ENSMUSG00000022996
AA Change: H81N

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
WNT1 50 389 9.1e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166022
AA Change: H81N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131056
Gene: ENSMUSG00000022996
AA Change: H81N

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
WNT1 50 389 9.1e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226610
AA Change: H81N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000226655
AA Change: H81N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000226846
AA Change: H81N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000228546
Predicted Effect probably damaging
Transcript: ENSMUST00000228594
AA Change: H81N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.1475 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It may be involved in breast cancer, and its protein signaling is likely a molecular switch that governs adipogenesis. This protein is 96% identical to the mouse Wnt10b protein at the amino acid level. This gene is clustered with another family member, WNT1, in the chromosome 12q13 region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice fed a low- or high-fat diet exhibit accelerated myogenic differentiation of myoblasts and those fed a high-fat diet exhibit excessive lipid accumulation in actively regenerating muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,294,076 K98E possibly damaging Het
4933414I15Rik A T 11: 50,942,589 M62K unknown Het
Akr1d1 T A 6: 37,536,014 probably null Het
Ankrd63 T C 2: 118,703,255 probably benign Het
Atad5 T C 11: 80,095,062 V325A probably damaging Het
Atp13a5 G T 16: 29,248,279 N1025K probably damaging Het
Atrnl1 G T 19: 57,650,335 V302L probably benign Het
Bend7 C A 2: 4,752,978 S277* probably null Het
Btnl7-ps A T 17: 34,533,287 noncoding transcript Het
Cbx4 T C 11: 119,081,928 Y207C probably damaging Het
Ctla2b C T 13: 60,896,332 W63* probably null Het
Cux1 T C 5: 136,370,173 T170A probably benign Het
Cyp3a57 T C 5: 145,365,697 V101A probably benign Het
Dao A T 5: 114,021,033 T267S probably benign Het
Dsp A G 13: 38,186,770 D883G probably damaging Het
Eif4g3 C A 4: 138,096,794 P36T possibly damaging Het
Elf3 G A 1: 135,257,239 L70F probably benign Het
Epb41l4a C T 18: 33,810,313 D510N probably damaging Het
Gcn1l1 T C 5: 115,588,067 S594P probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gpr132 T C 12: 112,852,148 T353A probably benign Het
Kntc1 A G 5: 123,794,172 D1343G probably benign Het
L3mbtl4 T A 17: 68,764,722 probably null Het
Lrit2 A G 14: 37,072,353 E458G probably damaging Het
Man1c1 A T 4: 134,578,369 I348N probably damaging Het
Map4k2 A G 19: 6,346,504 probably benign Het
Nt5c2 A C 19: 46,898,629 Y203D probably damaging Het
Oxgr1 A G 14: 120,022,253 S181P probably damaging Het
Parn A G 16: 13,625,552 C400R probably benign Het
Pcdhgb7 T C 18: 37,752,524 V249A probably benign Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Plcg2 A T 8: 117,577,874 I273F possibly damaging Het
Plin1 A G 7: 79,722,699 V64A probably damaging Het
Ppfia4 C A 1: 134,304,286 probably null Het
Prkg2 A C 5: 98,976,462 D376E possibly damaging Het
Ptgir T A 7: 16,908,720 I82N probably damaging Het
Pum2 C T 12: 8,713,458 P205L possibly damaging Het
Rab26 T A 17: 24,534,133 probably benign Het
Recql4 T C 15: 76,710,129 E63G probably benign Het
Rora T A 9: 69,364,141 probably benign Het
Rp1 A C 1: 4,348,033 M952R probably benign Het
Rpap3 T A 15: 97,703,223 R44S possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc12a2 C A 18: 57,879,020 P72T probably damaging Het
Slc1a3 C T 15: 8,642,225 V416M probably damaging Het
Slfn4 A T 11: 83,187,549 M388L possibly damaging Het
Snrnp48 G A 13: 38,205,117 A49T probably benign Het
Tctex1d4 A G 4: 117,128,093 T38A possibly damaging Het
Tlx2 C T 6: 83,068,930 G228D possibly damaging Het
Tmem132a A G 19: 10,867,144 V30A possibly damaging Het
Tnfrsf23 C A 7: 143,685,785 L24F possibly damaging Het
Ubr2 A T 17: 46,983,270 N312K probably benign Het
Vmn1r115 C T 7: 20,844,244 V248I probably damaging Het
Vmn2r80 A G 10: 79,194,040 T567A probably benign Het
Vps13c A G 9: 67,945,553 T2372A probably benign Het
Zfp948 A G 17: 21,588,243 T566A probably benign Het
Other mutations in Wnt10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Wnt10b APN 15 98776945 utr 5 prime probably benign
R0555:Wnt10b UTSW 15 98772937 splice site probably benign
R1747:Wnt10b UTSW 15 98774333 missense probably benign 0.00
R1751:Wnt10b UTSW 15 98772675 missense probably damaging 0.99
R1767:Wnt10b UTSW 15 98772675 missense probably damaging 0.99
R2272:Wnt10b UTSW 15 98774347 missense probably damaging 0.99
R2282:Wnt10b UTSW 15 98774221 missense probably damaging 0.99
R3911:Wnt10b UTSW 15 98774338 missense possibly damaging 0.53
R4997:Wnt10b UTSW 15 98774203 missense probably damaging 0.99
R7514:Wnt10b UTSW 15 98774164 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TGACCAGATCTAGCTGAGCG -3'
(R):5'- AAGCACCGATCTGGGTTAGG -3'

Sequencing Primer
(F):5'- GCAGCTCCTGGGGAAATTC -3'
(R):5'- TAGACCCCAGACCCTTGTCG -3'
Posted On2016-07-22