Incidental Mutation 'R5226:Parn'
ID402638
Institutional Source Beutler Lab
Gene Symbol Parn
Ensembl Gene ENSMUSG00000022685
Gene Namepoly(A)-specific ribonuclease (deadenylation nuclease)
SynonymsDAN, 1200003I18Rik
MMRRC Submission 042799-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R5226 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location13537960-13668170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13625552 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 400 (C400R)
Ref Sequence ENSEMBL: ENSMUSP00000055969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058884] [ENSMUST00000231003]
Predicted Effect probably benign
Transcript: ENSMUST00000058884
AA Change: C400R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055969
Gene: ENSMUSG00000022685
AA Change: C400R

DomainStartEndE-ValueType
Pfam:CAF1 3 383 2.7e-86 PFAM
Pfam:R3H 172 236 2.8e-13 PFAM
Pfam:RNA_bind 430 508 2.2e-37 PFAM
low complexity region 564 578 N/A INTRINSIC
low complexity region 591 606 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231003
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a 3'-exoribonuclease, with similarity to the RNase D family of 3'-exonucleases. It prefers poly(A) as the substrate, hence, efficiently degrades poly(A) tails of mRNAs. Exonucleolytic degradation of the poly(A) tail is often the first step in the decay of eukaryotic mRNAs. This protein is also involved in silencing of certain maternal mRNAs during oocyte maturation and early embryonic development, as well as in nonsense-mediated decay (NMD) of mRNAs that contain premature stop codons. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,294,076 K98E possibly damaging Het
4933414I15Rik A T 11: 50,942,589 M62K unknown Het
Akr1d1 T A 6: 37,536,014 probably null Het
Ankrd63 T C 2: 118,703,255 probably benign Het
Atad5 T C 11: 80,095,062 V325A probably damaging Het
Atp13a5 G T 16: 29,248,279 N1025K probably damaging Het
Atrnl1 G T 19: 57,650,335 V302L probably benign Het
Bend7 C A 2: 4,752,978 S277* probably null Het
Btnl7-ps A T 17: 34,533,287 noncoding transcript Het
Cbx4 T C 11: 119,081,928 Y207C probably damaging Het
Ctla2b C T 13: 60,896,332 W63* probably null Het
Cux1 T C 5: 136,370,173 T170A probably benign Het
Cyp3a57 T C 5: 145,365,697 V101A probably benign Het
Dao A T 5: 114,021,033 T267S probably benign Het
Dsp A G 13: 38,186,770 D883G probably damaging Het
Eif4g3 C A 4: 138,096,794 P36T possibly damaging Het
Elf3 G A 1: 135,257,239 L70F probably benign Het
Epb41l4a C T 18: 33,810,313 D510N probably damaging Het
Gcn1l1 T C 5: 115,588,067 S594P probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gpr132 T C 12: 112,852,148 T353A probably benign Het
Kntc1 A G 5: 123,794,172 D1343G probably benign Het
L3mbtl4 T A 17: 68,764,722 probably null Het
Lrit2 A G 14: 37,072,353 E458G probably damaging Het
Man1c1 A T 4: 134,578,369 I348N probably damaging Het
Map4k2 A G 19: 6,346,504 probably benign Het
Nt5c2 A C 19: 46,898,629 Y203D probably damaging Het
Oxgr1 A G 14: 120,022,253 S181P probably damaging Het
Pcdhgb7 T C 18: 37,752,524 V249A probably benign Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Plcg2 A T 8: 117,577,874 I273F possibly damaging Het
Plin1 A G 7: 79,722,699 V64A probably damaging Het
Ppfia4 C A 1: 134,304,286 probably null Het
Prkg2 A C 5: 98,976,462 D376E possibly damaging Het
Ptgir T A 7: 16,908,720 I82N probably damaging Het
Pum2 C T 12: 8,713,458 P205L possibly damaging Het
Rab26 T A 17: 24,534,133 probably benign Het
Recql4 T C 15: 76,710,129 E63G probably benign Het
Rora T A 9: 69,364,141 probably benign Het
Rp1 A C 1: 4,348,033 M952R probably benign Het
Rpap3 T A 15: 97,703,223 R44S possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc12a2 C A 18: 57,879,020 P72T probably damaging Het
Slc1a3 C T 15: 8,642,225 V416M probably damaging Het
Slfn4 A T 11: 83,187,549 M388L possibly damaging Het
Snrnp48 G A 13: 38,205,117 A49T probably benign Het
Tctex1d4 A G 4: 117,128,093 T38A possibly damaging Het
Tlx2 C T 6: 83,068,930 G228D possibly damaging Het
Tmem132a A G 19: 10,867,144 V30A possibly damaging Het
Tnfrsf23 C A 7: 143,685,785 L24F possibly damaging Het
Ubr2 A T 17: 46,983,270 N312K probably benign Het
Vmn1r115 C T 7: 20,844,244 V248I probably damaging Het
Vmn2r80 A G 10: 79,194,040 T567A probably benign Het
Vps13c A G 9: 67,945,553 T2372A probably benign Het
Wnt10b G T 15: 98,776,614 H81N probably damaging Het
Zfp948 A G 17: 21,588,243 T566A probably benign Het
Other mutations in Parn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Parn APN 16 13667603 missense probably benign
IGL02030:Parn APN 16 13664650 splice site probably null
IGL02179:Parn APN 16 13667592 missense probably benign 0.00
IGL02336:Parn APN 16 13566703 missense probably damaging 1.00
arlette UTSW 16 13606171 missense probably damaging 1.00
PIT4453001:Parn UTSW 16 13607281 missense probably benign 0.00
PIT4651001:Parn UTSW 16 13631567 missense probably benign 0.25
R0388:Parn UTSW 16 13654476 missense possibly damaging 0.72
R0485:Parn UTSW 16 13654435 splice site probably benign
R0625:Parn UTSW 16 13640294 missense probably benign 0.02
R1104:Parn UTSW 16 13667585 missense probably damaging 0.99
R1299:Parn UTSW 16 13664729 missense probably benign 0.10
R1356:Parn UTSW 16 13650674 nonsense probably null
R2067:Parn UTSW 16 13603069 missense probably damaging 1.00
R2111:Parn UTSW 16 13603069 missense probably damaging 1.00
R2397:Parn UTSW 16 13566654 missense probably benign
R4473:Parn UTSW 16 13664685 missense probably benign 0.00
R4474:Parn UTSW 16 13664685 missense probably benign 0.00
R4475:Parn UTSW 16 13664685 missense probably benign 0.00
R4476:Parn UTSW 16 13664685 missense probably benign 0.00
R4665:Parn UTSW 16 13541103 missense probably benign 0.19
R4795:Parn UTSW 16 13606202 missense probably benign 0.06
R5122:Parn UTSW 16 13654447 critical splice donor site probably null
R5355:Parn UTSW 16 13668022 missense possibly damaging 0.92
R5570:Parn UTSW 16 13665930 missense probably damaging 0.98
R5979:Parn UTSW 16 13606171 missense probably damaging 1.00
R6009:Parn UTSW 16 13667564 missense probably damaging 1.00
R6173:Parn UTSW 16 13651811 missense possibly damaging 0.82
R6493:Parn UTSW 16 13656925 missense probably damaging 1.00
R7055:Parn UTSW 16 13626134 missense possibly damaging 0.80
R7278:Parn UTSW 16 13626063 intron probably null
R7391:Parn UTSW 16 13668006 splice site probably null
R7706:Parn UTSW 16 13607253 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTCTTAGCTCAGCATCC -3'
(R):5'- GCCGTCCTTATAGAAGCAGG -3'

Sequencing Primer
(F):5'- GCATCCCTTGAAGGTAATTTAAATGC -3'
(R):5'- CGTCCTTATAGAAGCAGGAGGGTG -3'
Posted On2016-07-22