Mutagenetix > Incidental Mutations

Incidental Mutation 'R5226:Ubr2'

402644

Institutional Source

Beutler Lab

Gene Symbol

Ubr2

Ensembl Gene

ENSMUSG00000023977

Gene Name

ubiquitin protein ligase E3 component n-recognin 2

Synonyms

9930021A08Rik, E130209G04Rik, ENSMUSG00000043296

MMRRC Submission

042799-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.892) question?

Stock #

R5226 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46928295-47010556 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 46983270 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 312 (N312K)

Ref Sequence

ENSEMBL: ENSMUSP00000108963 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113335] [ENSMUST00000113337] [ENSMUST00000225599]

Predicted Effect

probably benign
Transcript: ENSMUST00000113335
AA Change: N312K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000108961
Gene: ENSMUSG00000023977
AA Change: N312K

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	3.14e-32	SMART
Pfam:ClpS	221	302	2.4e-23	PFAM
low complexity region	635	646	N/A	INTRINSIC
low complexity region	749	760	N/A	INTRINSIC
low complexity region	872	886	N/A	INTRINSIC
coiled coil region	1019	1046	N/A	INTRINSIC
RING	1108	1213	7.66e-1	SMART
low complexity region	1221	1235	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113337
AA Change: N312K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000108963
Gene: ENSMUSG00000023977
AA Change: N312K

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	3.14e-32	SMART
Pfam:ClpS	222	301	6.2e-26	PFAM
low complexity region	635	646	N/A	INTRINSIC
low complexity region	749	760	N/A	INTRINSIC
low complexity region	872	886	N/A	INTRINSIC
coiled coil region	1019	1046	N/A	INTRINSIC
RING	1108	1213	7.66e-1	SMART
low complexity region	1221	1235	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224759

Predicted Effect

probably benign
Transcript: ENSMUST00000225599

Meta Mutation Damage Score

0.0728

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin ligase of the N-end rule proteolytic pathway that targets proteins with destabilizing N-terminal residues for polyubiquitylation and proteasome-mediated degradation. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: On a mixed genetic background, female homozygotes for a targeted null mutation exhibit embryonic lethality, while males are viable, but sterile due to postnatal testicular degeneration. On an inbred background, both genders die in utero. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	C	9: 124,294,076	K98E	possibly damaging	Het
4933414I15Rik	A	T	11: 50,942,589	M62K	unknown	Het
Akr1d1	T	A	6: 37,536,014		probably null	Het
Ankrd63	T	C	2: 118,703,255		probably benign	Het
Atad5	T	C	11: 80,095,062	V325A	probably damaging	Het
Atp13a5	G	T	16: 29,248,279	N1025K	probably damaging	Het
Atrnl1	G	T	19: 57,650,335	V302L	probably benign	Het
Bend7	C	A	2: 4,752,978	S277*	probably null	Het
Btnl7-ps	A	T	17: 34,533,287		noncoding transcript	Het
Cbx4	T	C	11: 119,081,928	Y207C	probably damaging	Het
Ctla2b	C	T	13: 60,896,332	W63*	probably null	Het
Cux1	T	C	5: 136,370,173	T170A	probably benign	Het
Cyp3a57	T	C	5: 145,365,697	V101A	probably benign	Het
Dao	A	T	5: 114,021,033	T267S	probably benign	Het
Dsp	A	G	13: 38,186,770	D883G	probably damaging	Het
Eif4g3	C	A	4: 138,096,794	P36T	possibly damaging	Het
Elf3	G	A	1: 135,257,239	L70F	probably benign	Het
Epb41l4a	C	T	18: 33,810,313	D510N	probably damaging	Het
Gcn1l1	T	C	5: 115,588,067	S594P	probably benign	Het
Gm10722	T	C	9: 3,000,937	C6R	probably benign	Het
Gpr132	T	C	12: 112,852,148	T353A	probably benign	Het
Kntc1	A	G	5: 123,794,172	D1343G	probably benign	Het
L3mbtl4	T	A	17: 68,764,722		probably null	Het
Lrit2	A	G	14: 37,072,353	E458G	probably damaging	Het
Man1c1	A	T	4: 134,578,369	I348N	probably damaging	Het
Map4k2	A	G	19: 6,346,504		probably benign	Het
Nt5c2	A	C	19: 46,898,629	Y203D	probably damaging	Het
Oxgr1	A	G	14: 120,022,253	S181P	probably damaging	Het
Parn	A	G	16: 13,625,552	C400R	probably benign	Het
Pcdhgb7	T	C	18: 37,752,524	V249A	probably benign	Het
Pdzrn3	C	T	6: 101,153,311	D515N	probably damaging	Het
Plcg2	A	T	8: 117,577,874	I273F	possibly damaging	Het
Plin1	A	G	7: 79,722,699	V64A	probably damaging	Het
Ppfia4	C	A	1: 134,304,286		probably null	Het
Prkg2	A	C	5: 98,976,462	D376E	possibly damaging	Het
Ptgir	T	A	7: 16,908,720	I82N	probably damaging	Het
Pum2	C	T	12: 8,713,458	P205L	possibly damaging	Het
Rab26	T	A	17: 24,534,133		probably benign	Het
Recql4	T	C	15: 76,710,129	E63G	probably benign	Het
Rora	T	A	9: 69,364,141		probably benign	Het
Rp1	A	C	1: 4,348,033	M952R	probably benign	Het
Rpap3	T	A	15: 97,703,223	R44S	possibly damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Slc12a2	C	A	18: 57,879,020	P72T	probably damaging	Het
Slc1a3	C	T	15: 8,642,225	V416M	probably damaging	Het
Slfn4	A	T	11: 83,187,549	M388L	possibly damaging	Het
Snrnp48	G	A	13: 38,205,117	A49T	probably benign	Het
Tctex1d4	A	G	4: 117,128,093	T38A	possibly damaging	Het
Tlx2	C	T	6: 83,068,930	G228D	possibly damaging	Het
Tmem132a	A	G	19: 10,867,144	V30A	possibly damaging	Het
Tnfrsf23	C	A	7: 143,685,785	L24F	possibly damaging	Het
Vmn1r115	C	T	7: 20,844,244	V248I	probably damaging	Het
Vmn2r80	A	G	10: 79,194,040	T567A	probably benign	Het
Vps13c	A	G	9: 67,945,553	T2372A	probably benign	Het
Wnt10b	G	T	15: 98,776,614	H81N	probably damaging	Het
Zfp948	A	G	17: 21,588,243	T566A	probably benign	Het

Other mutations in Ubr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Ubr2	APN	17	46986060	splice site	probably benign
IGL00332:Ubr2	APN	17	46990990	critical splice donor site	probably null
IGL00518:Ubr2	APN	17	46992996	missense	probably damaging	1.00
IGL00693:Ubr2	APN	17	46972981	missense	probably benign	0.01
IGL00785:Ubr2	APN	17	46944865	missense	possibly damaging	0.69
IGL01144:Ubr2	APN	17	46957321	missense	probably damaging	1.00
IGL01459:Ubr2	APN	17	46930509	splice site	probably benign
IGL01637:Ubr2	APN	17	46956654	missense	probably damaging	1.00
IGL01710:Ubr2	APN	17	46943409	missense	probably benign	0.00
IGL01726:Ubr2	APN	17	46992981	splice site	probably benign
IGL01925:Ubr2	APN	17	46954949	missense	possibly damaging	0.92
IGL01960:Ubr2	APN	17	46973967	missense	probably benign	0.45
IGL02170:Ubr2	APN	17	46967197	missense	probably benign	0.05
IGL02308:Ubr2	APN	17	46934193	missense	probably damaging	1.00
IGL02387:Ubr2	APN	17	46963150	missense	probably benign
IGL02696:Ubr2	APN	17	46963765	missense	probably benign
IGL02726:Ubr2	APN	17	46972921	missense	probably damaging	1.00
IGL02750:Ubr2	APN	17	46969282	missense	probably benign	0.00
IGL02934:Ubr2	APN	17	46957340	missense	possibly damaging	0.50
IGL02959:Ubr2	APN	17	46975951	missense	probably damaging	0.96
IGL03018:Ubr2	APN	17	46954046	missense	possibly damaging	0.64
IGL03343:Ubr2	APN	17	46951918	missense	probably benign	0.00
PIT4280001:Ubr2	UTSW	17	46944863	missense	probably damaging	1.00
R0044:Ubr2	UTSW	17	46992985	splice site	probably benign
R0044:Ubr2	UTSW	17	46992985	splice site	probably benign
R0446:Ubr2	UTSW	17	46983298	missense	probably damaging	1.00
R0513:Ubr2	UTSW	17	46986779	nonsense	probably null
R0565:Ubr2	UTSW	17	46955886	missense	probably damaging	1.00
R0600:Ubr2	UTSW	17	46967248	missense	probably damaging	0.99
R0690:Ubr2	UTSW	17	46938653	missense	probably damaging	0.97
R0710:Ubr2	UTSW	17	46938681	missense	probably damaging	0.96
R0761:Ubr2	UTSW	17	46983316	missense	probably damaging	1.00
R0798:Ubr2	UTSW	17	46969176	splice site	probably benign
R0862:Ubr2	UTSW	17	46967083	nonsense	probably null
R0947:Ubr2	UTSW	17	46941112	missense	probably damaging	0.99
R0972:Ubr2	UTSW	17	46934261	splice site	probably null
R1500:Ubr2	UTSW	17	46986689	missense	possibly damaging	0.79
R1514:Ubr2	UTSW	17	47000823	missense	probably damaging	1.00
R1533:Ubr2	UTSW	17	46967247	nonsense	probably null
R1554:Ubr2	UTSW	17	46972951	missense	probably benign
R1575:Ubr2	UTSW	17	46932492	missense	probably damaging	1.00
R1602:Ubr2	UTSW	17	46941061	missense	probably benign	0.30
R1941:Ubr2	UTSW	17	46974026	missense	probably damaging	1.00
R1966:Ubr2	UTSW	17	46954919	missense	probably benign	0.05
R2041:Ubr2	UTSW	17	46986047	missense	probably damaging	1.00
R2067:Ubr2	UTSW	17	46963145	critical splice donor site	probably null
R2111:Ubr2	UTSW	17	46963145	critical splice donor site	probably null
R2189:Ubr2	UTSW	17	46943364	missense	probably benign	0.01
R2219:Ubr2	UTSW	17	46986042	missense	possibly damaging	0.94
R2307:Ubr2	UTSW	17	46966215	nonsense	probably null
R3426:Ubr2	UTSW	17	46968439	missense	probably damaging	1.00
R3428:Ubr2	UTSW	17	46968439	missense	probably damaging	1.00
R3608:Ubr2	UTSW	17	46944523	missense	probably damaging	1.00
R4080:Ubr2	UTSW	17	46988722	missense	probably benign	0.05
R4330:Ubr2	UTSW	17	46967278	missense	probably null	1.00
R4383:Ubr2	UTSW	17	46939387	missense	probably benign	0.01
R4460:Ubr2	UTSW	17	46945045	critical splice donor site	probably null
R4794:Ubr2	UTSW	17	46930445	missense	probably damaging	1.00
R4902:Ubr2	UTSW	17	46985996	missense	possibly damaging	0.91
R4913:Ubr2	UTSW	17	46959459	splice site	probably null
R5092:Ubr2	UTSW	17	46969247	missense	probably damaging	1.00
R5209:Ubr2	UTSW	17	46968424	missense	probably damaging	1.00
R5250:Ubr2	UTSW	17	46930442	missense	probably benign	0.01
R5437:Ubr2	UTSW	17	46963697	missense	probably benign	0.00
R5607:Ubr2	UTSW	17	46934200	nonsense	probably null
R5848:Ubr2	UTSW	17	46956655	missense	possibly damaging	0.84
R6089:Ubr2	UTSW	17	46982292	missense	possibly damaging	0.95
R6382:Ubr2	UTSW	17	46957315	missense	possibly damaging	0.56
R6552:Ubr2	UTSW	17	46966268	splice site	probably null
R6630:Ubr2	UTSW	17	46951984	missense	possibly damaging	0.51
R6892:Ubr2	UTSW	17	46934108	missense	probably damaging	0.99
R6936:Ubr2	UTSW	17	46973031	missense	possibly damaging	0.94
R7039:Ubr2	UTSW	17	47010213	missense	probably benign	0.01
R7050:Ubr2	UTSW	17	46961602	missense	probably benign	0.30
R7078:Ubr2	UTSW	17	46955853	missense	possibly damaging	0.59
R7126:Ubr2	UTSW	17	46974056	splice site	probably null
R7219:Ubr2	UTSW	17	46935434	nonsense	probably null
R7262:Ubr2	UTSW	17	47000739	missense	probably damaging	0.97
R7352:Ubr2	UTSW	17	46930426	missense	probably benign	0.19
R7366:Ubr2	UTSW	17	46955845	missense	probably damaging	0.99
R7449:Ubr2	UTSW	17	46964788	missense	probably damaging	1.00
R7496:Ubr2	UTSW	17	46990991	critical splice donor site	probably null
R7759:Ubr2	UTSW	17	46986048	missense	probably damaging	1.00
R7869:Ubr2	UTSW	17	46991008	missense	probably benign	0.00
R7916:Ubr2	UTSW	17	46968382	critical splice donor site	probably null
R8236:Ubr2	UTSW	17	46951909	missense	probably benign
R8376:Ubr2	UTSW	17	46942795	missense	probably benign	0.07
X0027:Ubr2	UTSW	17	47000629	missense	probably damaging	0.99
X0061:Ubr2	UTSW	17	46970111	missense	possibly damaging	0.88
Z1177:Ubr2	UTSW	17	46959509	missense	probably benign
Z1177:Ubr2	UTSW	17	47000766	missense	possibly damaging	0.76
Z1177:Ubr2	UTSW	17	47010143	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- TCACTGGGTTCTAATTATGGCAGC -3'
(R):5'- CACAAGATGGGGTCTCTCACTG -3'

Sequencing Primer
(F):5'- CATTTTGCAGCTTGGCTTAGAAATGC -3'
(R):5'- AAGATGGGGTCTCTCACTGTTGTC -3'

Posted On

2016-07-22