Incidental Mutation 'R5226:L3mbtl4'
ID402645
Institutional Source Beutler Lab
Gene Symbol L3mbtl4
Ensembl Gene ENSMUSG00000041565
Gene NameL3MBTL4 histone methyl-lysine binding protein
Synonyms
MMRRC Submission 042799-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5226 (G1)
Quality Score144
Status Validated
Chromosome17
Chromosomal Location68273797-68777961 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 68764722 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000094892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093007]
Predicted Effect probably null
Transcript: ENSMUST00000093007
SMART Domains Protein: ENSMUSP00000094892
Gene: ENSMUSG00000041565

DomainStartEndE-ValueType
MBT 52 152 2.24e-46 SMART
MBT 160 260 6.29e-41 SMART
MBT 269 364 2.8e-47 SMART
Pfam:zf-C2HC 378 407 8.1e-16 PFAM
SAM 540 607 5.17e-11 SMART
Meta Mutation Damage Score 0.9327 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,294,076 K98E possibly damaging Het
4933414I15Rik A T 11: 50,942,589 M62K unknown Het
Akr1d1 T A 6: 37,536,014 probably null Het
Ankrd63 T C 2: 118,703,255 probably benign Het
Atad5 T C 11: 80,095,062 V325A probably damaging Het
Atp13a5 G T 16: 29,248,279 N1025K probably damaging Het
Atrnl1 G T 19: 57,650,335 V302L probably benign Het
Bend7 C A 2: 4,752,978 S277* probably null Het
Btnl7-ps A T 17: 34,533,287 noncoding transcript Het
Cbx4 T C 11: 119,081,928 Y207C probably damaging Het
Ctla2b C T 13: 60,896,332 W63* probably null Het
Cux1 T C 5: 136,370,173 T170A probably benign Het
Cyp3a57 T C 5: 145,365,697 V101A probably benign Het
Dao A T 5: 114,021,033 T267S probably benign Het
Dsp A G 13: 38,186,770 D883G probably damaging Het
Eif4g3 C A 4: 138,096,794 P36T possibly damaging Het
Elf3 G A 1: 135,257,239 L70F probably benign Het
Epb41l4a C T 18: 33,810,313 D510N probably damaging Het
Gcn1l1 T C 5: 115,588,067 S594P probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gpr132 T C 12: 112,852,148 T353A probably benign Het
Kntc1 A G 5: 123,794,172 D1343G probably benign Het
Lrit2 A G 14: 37,072,353 E458G probably damaging Het
Man1c1 A T 4: 134,578,369 I348N probably damaging Het
Map4k2 A G 19: 6,346,504 probably benign Het
Nt5c2 A C 19: 46,898,629 Y203D probably damaging Het
Oxgr1 A G 14: 120,022,253 S181P probably damaging Het
Parn A G 16: 13,625,552 C400R probably benign Het
Pcdhgb7 T C 18: 37,752,524 V249A probably benign Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Plcg2 A T 8: 117,577,874 I273F possibly damaging Het
Plin1 A G 7: 79,722,699 V64A probably damaging Het
Ppfia4 C A 1: 134,304,286 probably null Het
Prkg2 A C 5: 98,976,462 D376E possibly damaging Het
Ptgir T A 7: 16,908,720 I82N probably damaging Het
Pum2 C T 12: 8,713,458 P205L possibly damaging Het
Rab26 T A 17: 24,534,133 probably benign Het
Recql4 T C 15: 76,710,129 E63G probably benign Het
Rora T A 9: 69,364,141 probably benign Het
Rp1 A C 1: 4,348,033 M952R probably benign Het
Rpap3 T A 15: 97,703,223 R44S possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc12a2 C A 18: 57,879,020 P72T probably damaging Het
Slc1a3 C T 15: 8,642,225 V416M probably damaging Het
Slfn4 A T 11: 83,187,549 M388L possibly damaging Het
Snrnp48 G A 13: 38,205,117 A49T probably benign Het
Tctex1d4 A G 4: 117,128,093 T38A possibly damaging Het
Tlx2 C T 6: 83,068,930 G228D possibly damaging Het
Tmem132a A G 19: 10,867,144 V30A possibly damaging Het
Tnfrsf23 C A 7: 143,685,785 L24F possibly damaging Het
Ubr2 A T 17: 46,983,270 N312K probably benign Het
Vmn1r115 C T 7: 20,844,244 V248I probably damaging Het
Vmn2r80 A G 10: 79,194,040 T567A probably benign Het
Vps13c A G 9: 67,945,553 T2372A probably benign Het
Wnt10b G T 15: 98,776,614 H81N probably damaging Het
Zfp948 A G 17: 21,588,243 T566A probably benign Het
Other mutations in L3mbtl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:L3mbtl4 APN 17 68630202 missense probably damaging 1.00
IGL02274:L3mbtl4 APN 17 68764584 missense probably benign 0.01
IGL02304:L3mbtl4 APN 17 68587185 nonsense probably null
IGL02473:L3mbtl4 APN 17 68559777 missense possibly damaging 0.93
IGL02543:L3mbtl4 APN 17 68461612 splice site probably benign
IGL02706:L3mbtl4 APN 17 68486919 missense probably damaging 1.00
IGL02729:L3mbtl4 APN 17 68484743 missense probably benign 0.23
IGL02817:L3mbtl4 APN 17 68630254 missense probably benign 0.30
IGL03237:L3mbtl4 APN 17 68777861 missense probably damaging 1.00
IGL03371:L3mbtl4 APN 17 68461568 missense probably damaging 1.00
R0092:L3mbtl4 UTSW 17 68425703 missense probably benign 0.01
R0389:L3mbtl4 UTSW 17 68455780 missense probably damaging 1.00
R0504:L3mbtl4 UTSW 17 68777912 missense probably benign 0.07
R0598:L3mbtl4 UTSW 17 68459773 missense probably benign 0.04
R0650:L3mbtl4 UTSW 17 68774291 missense probably damaging 1.00
R0652:L3mbtl4 UTSW 17 68774291 missense probably damaging 1.00
R0842:L3mbtl4 UTSW 17 68486962 missense probably benign 0.19
R1900:L3mbtl4 UTSW 17 68459805 missense probably damaging 0.99
R2065:L3mbtl4 UTSW 17 68425692 missense probably benign 0.04
R2173:L3mbtl4 UTSW 17 68587193 missense probably damaging 1.00
R2987:L3mbtl4 UTSW 17 68359518 missense possibly damaging 0.89
R3119:L3mbtl4 UTSW 17 68425674 missense probably benign 0.02
R3153:L3mbtl4 UTSW 17 68457248 nonsense probably null
R4044:L3mbtl4 UTSW 17 68777914 missense possibly damaging 0.63
R4579:L3mbtl4 UTSW 17 68764640 missense probably benign
R4717:L3mbtl4 UTSW 17 68455713 missense probably null 0.67
R4798:L3mbtl4 UTSW 17 68359480 start codon destroyed probably null 0.03
R4831:L3mbtl4 UTSW 17 68461563 missense probably damaging 0.98
R4852:L3mbtl4 UTSW 17 68559753 missense probably damaging 1.00
R5402:L3mbtl4 UTSW 17 68455774 missense probably damaging 1.00
R5604:L3mbtl4 UTSW 17 68777922 missense probably benign 0.01
R6377:L3mbtl4 UTSW 17 68777923 missense probably benign 0.04
R6708:L3mbtl4 UTSW 17 68630258 missense probably benign 0.19
R6853:L3mbtl4 UTSW 17 68777920 missense probably damaging 0.97
R6905:L3mbtl4 UTSW 17 68777888 missense probably benign 0.05
R7018:L3mbtl4 UTSW 17 68486943 missense probably damaging 1.00
R7045:L3mbtl4 UTSW 17 68461566 missense probably benign 0.00
R7047:L3mbtl4 UTSW 17 68461566 missense probably benign 0.00
R7049:L3mbtl4 UTSW 17 68461566 missense probably benign 0.00
R7419:L3mbtl4 UTSW 17 68641542 missense probably benign 0.28
X0063:L3mbtl4 UTSW 17 68630253 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AGTGTCTGTGCTCTGCTCAC -3'
(R):5'- AGGCAGACAGTGGGATTTCC -3'

Sequencing Primer
(F):5'- TCTCTTGCAGAGTACTCAGCTG -3'
(R):5'- CAGACAGTGGGATTTCCTAGATTC -3'
Posted On2016-07-22