Incidental Mutation 'R5226:Map4k2'
ID402648
Institutional Source Beutler Lab
Gene Symbol Map4k2
Ensembl Gene ENSMUSG00000024948
Gene Namemitogen-activated protein kinase kinase kinase kinase 2
SynonymsRab8ip, BL44
MMRRC Submission 042799-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.341) question?
Stock #R5226 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6341135-6355615 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 6346504 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025897] [ENSMUST00000124556] [ENSMUST00000130382] [ENSMUST00000142496] [ENSMUST00000152349]
Predicted Effect probably benign
Transcript: ENSMUST00000025897
SMART Domains Protein: ENSMUSP00000025897
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
S_TKc 16 273 2.41e-90 SMART
low complexity region 358 369 N/A INTRINSIC
low complexity region 425 444 N/A INTRINSIC
CNH 488 801 1.31e-128 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124333
Predicted Effect probably benign
Transcript: ENSMUST00000124556
SMART Domains Protein: ENSMUSP00000121375
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:Pkinase 16 56 4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127809
Predicted Effect probably benign
Transcript: ENSMUST00000128170
SMART Domains Protein: ENSMUSP00000121856
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:CNH 2 142 3.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130382
SMART Domains Protein: ENSMUSP00000120123
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
S_TKc 16 233 3.4e-14 SMART
low complexity region 314 325 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140098
Predicted Effect probably benign
Transcript: ENSMUST00000142496
SMART Domains Protein: ENSMUSP00000114243
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:Pkinase 16 56 4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152259
Predicted Effect probably benign
Transcript: ENSMUST00000152349
SMART Domains Protein: ENSMUSP00000115741
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:Pkinase 16 57 3.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184812
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. Although this kinase is found in many tissues, its expression in lymphoid follicles is restricted to the cells of germinal centre, where it may participate in B-cell differentiation. This kinase can be activated by TNF-alpha, and has been shown to specifically activate MAP kinases. This kinase is also found to interact with TNF receptor-associated factor 2 (TRAF2), which is involved in the activation of MAP3K1/MEKK1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased susceptibility to endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,294,076 K98E possibly damaging Het
4933414I15Rik A T 11: 50,942,589 M62K unknown Het
Akr1d1 T A 6: 37,536,014 probably null Het
Ankrd63 T C 2: 118,703,255 probably benign Het
Atad5 T C 11: 80,095,062 V325A probably damaging Het
Atp13a5 G T 16: 29,248,279 N1025K probably damaging Het
Atrnl1 G T 19: 57,650,335 V302L probably benign Het
Bend7 C A 2: 4,752,978 S277* probably null Het
Btnl7-ps A T 17: 34,533,287 noncoding transcript Het
Cbx4 T C 11: 119,081,928 Y207C probably damaging Het
Ctla2b C T 13: 60,896,332 W63* probably null Het
Cux1 T C 5: 136,370,173 T170A probably benign Het
Cyp3a57 T C 5: 145,365,697 V101A probably benign Het
Dao A T 5: 114,021,033 T267S probably benign Het
Dsp A G 13: 38,186,770 D883G probably damaging Het
Eif4g3 C A 4: 138,096,794 P36T possibly damaging Het
Elf3 G A 1: 135,257,239 L70F probably benign Het
Epb41l4a C T 18: 33,810,313 D510N probably damaging Het
Gcn1l1 T C 5: 115,588,067 S594P probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gpr132 T C 12: 112,852,148 T353A probably benign Het
Kntc1 A G 5: 123,794,172 D1343G probably benign Het
L3mbtl4 T A 17: 68,764,722 probably null Het
Lrit2 A G 14: 37,072,353 E458G probably damaging Het
Man1c1 A T 4: 134,578,369 I348N probably damaging Het
Nt5c2 A C 19: 46,898,629 Y203D probably damaging Het
Oxgr1 A G 14: 120,022,253 S181P probably damaging Het
Parn A G 16: 13,625,552 C400R probably benign Het
Pcdhgb7 T C 18: 37,752,524 V249A probably benign Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Plcg2 A T 8: 117,577,874 I273F possibly damaging Het
Plin1 A G 7: 79,722,699 V64A probably damaging Het
Ppfia4 C A 1: 134,304,286 probably null Het
Prkg2 A C 5: 98,976,462 D376E possibly damaging Het
Ptgir T A 7: 16,908,720 I82N probably damaging Het
Pum2 C T 12: 8,713,458 P205L possibly damaging Het
Rab26 T A 17: 24,534,133 probably benign Het
Recql4 T C 15: 76,710,129 E63G probably benign Het
Rora T A 9: 69,364,141 probably benign Het
Rp1 A C 1: 4,348,033 M952R probably benign Het
Rpap3 T A 15: 97,703,223 R44S possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc12a2 C A 18: 57,879,020 P72T probably damaging Het
Slc1a3 C T 15: 8,642,225 V416M probably damaging Het
Slfn4 A T 11: 83,187,549 M388L possibly damaging Het
Snrnp48 G A 13: 38,205,117 A49T probably benign Het
Tctex1d4 A G 4: 117,128,093 T38A possibly damaging Het
Tlx2 C T 6: 83,068,930 G228D possibly damaging Het
Tmem132a A G 19: 10,867,144 V30A possibly damaging Het
Tnfrsf23 C A 7: 143,685,785 L24F possibly damaging Het
Ubr2 A T 17: 46,983,270 N312K probably benign Het
Vmn1r115 C T 7: 20,844,244 V248I probably damaging Het
Vmn2r80 A G 10: 79,194,040 T567A probably benign Het
Vps13c A G 9: 67,945,553 T2372A probably benign Het
Wnt10b G T 15: 98,776,614 H81N probably damaging Het
Zfp948 A G 17: 21,588,243 T566A probably benign Het
Other mutations in Map4k2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01607:Map4k2 APN 19 6345593 unclassified probably null
IGL02041:Map4k2 APN 19 6351318 missense probably benign 0.45
IGL03372:Map4k2 APN 19 6342249 unclassified probably benign
IGL03380:Map4k2 APN 19 6344590 missense possibly damaging 0.83
R0968:Map4k2 UTSW 19 6345457 missense probably damaging 0.98
R1466:Map4k2 UTSW 19 6341917 missense probably damaging 1.00
R1466:Map4k2 UTSW 19 6341917 missense probably damaging 1.00
R1612:Map4k2 UTSW 19 6343341 missense probably damaging 1.00
R2069:Map4k2 UTSW 19 6342738 unclassified probably benign
R2370:Map4k2 UTSW 19 6341928 nonsense probably null
R3080:Map4k2 UTSW 19 6353188 missense probably damaging 0.99
R3825:Map4k2 UTSW 19 6344051 missense probably benign 0.29
R3896:Map4k2 UTSW 19 6341928 nonsense probably null
R4088:Map4k2 UTSW 19 6353156 missense probably damaging 0.99
R4817:Map4k2 UTSW 19 6344429 missense probably damaging 0.97
R4888:Map4k2 UTSW 19 6344003 missense probably benign 0.07
R5544:Map4k2 UTSW 19 6345914 critical splice acceptor site probably null
R5687:Map4k2 UTSW 19 6345642 unclassified probably benign
R5688:Map4k2 UTSW 19 6346806 missense probably damaging 1.00
R5726:Map4k2 UTSW 19 6351332 missense probably damaging 0.99
R5750:Map4k2 UTSW 19 6351337 missense probably benign 0.15
R5908:Map4k2 UTSW 19 6351316 splice site probably benign
R6402:Map4k2 UTSW 19 6344081 critical splice donor site probably null
R6843:Map4k2 UTSW 19 6353447 missense probably damaging 0.98
R6942:Map4k2 UTSW 19 6346709 missense possibly damaging 0.95
R7227:Map4k2 UTSW 19 6346594 missense probably damaging 1.00
R7573:Map4k2 UTSW 19 6344064 missense probably benign
R7632:Map4k2 UTSW 19 6344054 missense probably benign
X0010:Map4k2 UTSW 19 6353318 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAATAACTTAGGACACCCTTAGC -3'
(R):5'- ATGCGCCCAGATATGTGTGG -3'

Sequencing Primer
(F):5'- CTTGGGCTAGGAACATGTGGC -3'
(R):5'- TGGATTTCCCTGAAGCGGAAC -3'
Posted On2016-07-22