Incidental Mutation 'R5227:Alx4'
ID402656
Institutional Source Beutler Lab
Gene Symbol Alx4
Ensembl Gene ENSMUSG00000040310
Gene Namearistaless-like homeobox 4
SynonymsAristaless-like 4
MMRRC Submission 042800-MU
Accession Numbers

Genbank: NM_007442; MGI: 108359

Is this an essential gene? Possibly essential (E-score: 0.557) question?
Stock #R5227 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location93642384-93681339 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93677380 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 340 (V340D)
Ref Sequence ENSEMBL: ENSMUSP00000047962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042078] [ENSMUST00000111254] [ENSMUST00000184931]
Predicted Effect probably damaging
Transcript: ENSMUST00000042078
AA Change: V340D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000047962
Gene: ENSMUSG00000040310
AA Change: V340D

DomainStartEndE-ValueType
low complexity region 91 108 N/A INTRINSIC
HOX 202 264 1.11e-28 SMART
low complexity region 302 319 N/A INTRINSIC
Pfam:OAR 375 393 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111254
SMART Domains Protein: ENSMUSP00000106885
Gene: ENSMUSG00000040310

DomainStartEndE-ValueType
low complexity region 91 108 N/A INTRINSIC
HOX 202 264 1.11e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184931
SMART Domains Protein: ENSMUSP00000138956
Gene: ENSMUSG00000027198

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Pfam:Exostosin 100 380 1.4e-57 PFAM
Pfam:Glyco_transf_64 456 559 9.5e-31 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a paired-like homeodomain transcription factor expressed in the mesenchyme of developing bones, limbs, hair, teeth, and mammary tissue. Mutations in this gene cause parietal foramina 2 (PFM2); an autosomal dominant disease characterized by deficient ossification of the parietal bones. Mutations in this gene also cause a form of frontonasal dysplasia with alopecia and hypogonadism; suggesting a role for this gene in craniofacial development, mesenchymal-epithelial communication, and hair follicle development. Deletion of a segment of chromosome 11 containing this gene, del(11)(p11p12), causes Potocki-Shaffer syndrome (PSS); a syndrome characterized by craniofacial anomalies, mental retardation, multiple exostoses, and genital abnormalities in males. In mouse, this gene has been shown to use dual translation initiation sites located 16 codons apart. [provided by RefSeq, Oct 2009]
PHENOTYPE: Depending on genetic background mutant mice may show preaxial polydactyly and other skeletal alterations, transitory alopecia, ventral body wall defects and male sterility. Homozygous mice of one allele die prenatally. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Spontaneous(1) Chemically induced(3)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T C 17: 84,691,821 L115P probably damaging Het
Adgrb3 A C 1: 25,093,952 M481R possibly damaging Het
Adgrd1 C A 5: 129,122,583 N161K probably benign Het
Arid1a A G 4: 133,680,405 S2264P unknown Het
Azi2 A T 9: 118,047,458 H14L probably damaging Het
Camsap2 A G 1: 136,274,891 probably benign Het
Ccpg1 T A 9: 73,012,072 L323* probably null Het
Cpsf1 A T 15: 76,598,948 I943N probably damaging Het
Crebrf T A 17: 26,759,765 Y476N probably damaging Het
Defb10 T A 8: 21,861,878 Y46* probably null Het
Dock3 A G 9: 106,986,070 L703P probably damaging Het
Ebf2 A T 14: 67,247,069 I181F probably damaging Het
Eif3e T A 15: 43,251,521 M420L probably benign Het
Elmsan1 A T 12: 84,152,887 F1020I probably benign Het
Emilin3 T A 2: 160,909,265 Q188L probably damaging Het
Fbxl4 C T 4: 22,376,840 T92M probably damaging Het
Fer1l6 C T 15: 58,581,903 Q687* probably null Het
Fkrp T C 7: 16,810,710 E409G possibly damaging Het
Fzd9 T C 5: 135,249,606 D475G probably benign Het
Gabbr1 C T 17: 37,070,066 T767I possibly damaging Het
Gdf2 G A 14: 33,941,494 probably null Het
Gpatch1 T C 7: 35,309,351 N82D probably benign Het
Heg1 T A 16: 33,763,591 L1256Q probably damaging Het
Ireb2 T A 9: 54,896,601 probably null Het
Kansl1 T G 11: 104,356,814 H570P probably benign Het
Kcna10 T G 3: 107,194,428 M125R probably damaging Het
Lrp1b T G 2: 40,851,793 I3041L possibly damaging Het
Mbtd1 T C 11: 93,924,648 F354S possibly damaging Het
Mov10 T C 3: 104,802,578 T331A probably benign Het
Ms4a8a A T 19: 11,068,416 S243T probably damaging Het
Ndufa11 T C 17: 56,717,867 S10P probably benign Het
Olfml3 A G 3: 103,736,421 Y215H possibly damaging Het
Olfr315 T A 11: 58,778,879 F251I possibly damaging Het
Olfr663 A G 7: 104,704,322 I252V possibly damaging Het
Pclo T C 5: 14,713,560 S4016P probably benign Het
Pcyox1 G C 6: 86,391,744 A264G probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Pnisr A G 4: 21,874,587 probably benign Het
Prc1 T C 7: 80,313,179 S574P probably damaging Het
Ranbp3l T A 15: 9,007,312 V16D probably damaging Het
Rfx1 T C 8: 84,074,058 V96A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfmbt1 T C 14: 30,815,254 probably null Het
Siglecf T C 7: 43,351,940 Y111H probably damaging Het
Snx14 G A 9: 88,398,294 T536I possibly damaging Het
Spindoc A G 19: 7,374,147 V204A probably benign Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Swt1 G A 1: 151,402,976 Q227* probably null Het
Tg A G 15: 66,759,567 I562V possibly damaging Het
Trip11 T A 12: 101,884,920 I677F probably damaging Het
Vmn1r49 G A 6: 90,072,771 T83I probably benign Het
Vmn1r90 T C 7: 14,561,676 K166E possibly damaging Het
Vmn2r124 T C 17: 18,049,557 I25T possibly damaging Het
Vps13d A T 4: 145,181,207 probably null Het
Zfp106 T C 2: 120,523,968 I170V probably benign Het
Other mutations in Alx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01872:Alx4 APN 2 93677473 missense probably benign 0.10
goofy UTSW 2 93675369 missense probably damaging 1.00
PIT4519001:Alx4 UTSW 2 93675428 missense probably benign 0.00
R0367:Alx4 UTSW 2 93668608 missense probably damaging 1.00
R0436:Alx4 UTSW 2 93668357 nonsense probably null
R0864:Alx4 UTSW 2 93642855 missense probably damaging 1.00
R1913:Alx4 UTSW 2 93675387 missense probably damaging 1.00
R3712:Alx4 UTSW 2 93642789 missense possibly damaging 0.87
R4619:Alx4 UTSW 2 93642761 missense probably damaging 1.00
R5018:Alx4 UTSW 2 93677419 missense probably damaging 0.99
R6505:Alx4 UTSW 2 93668559 missense probably damaging 1.00
R7173:Alx4 UTSW 2 93642857 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGAGCCCCTTCTATACCACTG -3'
(R):5'- TTCTGTCATGTGGCCCAAG -3'

Sequencing Primer
(F):5'- CCAGCTGGCCTATGACATC -3'
(R):5'- CTGTCATGTGGCCCAAGAGATG -3'
Posted On2016-07-22