Mutagenetix > Incidental Mutation

Incidental Mutation 'R5227:Zfp106'

402658

Institutional Source

Beutler Lab

Gene Symbol

Zfp106

Ensembl Gene

ENSMUSG00000027288

Gene Name

zinc finger protein 106

Synonyms

Cd-1, H3a, Sh3bp3, sirm

MMRRC Submission

042800-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5227 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

120506820-120563843 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 120523968 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 170 (I170V)

Ref Sequence

ENSEMBL: ENSMUSP00000132902 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055241] [ENSMUST00000152347] [ENSMUST00000171215]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000055241
AA Change: I1464V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000055602
Gene: ENSMUSG00000027288
AA Change: I1464V

Domain	Start	End	E-Value	Type
ZnF_C2H2	5	29	1.51e0	SMART
ZnF_C2H2	43	67	7.18e1	SMART
low complexity region	75	92	N/A	INTRINSIC
low complexity region	141	152	N/A	INTRINSIC
low complexity region	199	212	N/A	INTRINSIC
low complexity region	466	480	N/A	INTRINSIC
coiled coil region	800	823	N/A	INTRINSIC
low complexity region	842	856	N/A	INTRINSIC
low complexity region	1049	1062	N/A	INTRINSIC
low complexity region	1312	1321	N/A	INTRINSIC
low complexity region	1361	1373	N/A	INTRINSIC
low complexity region	1389	1409	N/A	INTRINSIC
WD40	1525	1562	9.24e-4	SMART
WD40	1565	1607	1.83e-7	SMART
PQQ	1587	1618	3.42e2	SMART
WD40	1651	1691	3.45e-1	SMART
PQQ	1671	1702	9.14e1	SMART
WD40	1694	1731	2.12e-3	SMART
PQQ	1711	1742	6.42e0	SMART
WD40	1734	1771	6e-3	SMART
PQQ	1751	1782	5.7e2	SMART
WD40	1774	1811	3.58e-1	SMART
ZnF_C2H2	1818	1843	5.34e-1	SMART
ZnF_C2H2	1851	1879	1.31e2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139942

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141874

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149210

Predicted Effect

probably benign
Transcript: ENSMUST00000152347
AA Change: I170V

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000132902
Gene: ENSMUSG00000027288
AA Change: I170V

Domain	Start	End	E-Value	Type
low complexity region	66	75	N/A	INTRINSIC
low complexity region	115	127	N/A	INTRINSIC
low complexity region	143	163	N/A	INTRINSIC
Pfam:WD40	234	265	1.3e-5	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163384

Predicted Effect

probably benign
Transcript: ENSMUST00000171215
AA Change: I1441V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000128995
Gene: ENSMUSG00000027288
AA Change: I1441V

Domain	Start	End	E-Value	Type
ZnF_C2H2	20	44	7.18e1	SMART
low complexity region	52	69	N/A	INTRINSIC
low complexity region	118	129	N/A	INTRINSIC
low complexity region	176	189	N/A	INTRINSIC
low complexity region	443	457	N/A	INTRINSIC
coiled coil region	777	800	N/A	INTRINSIC
low complexity region	819	833	N/A	INTRINSIC
low complexity region	1026	1039	N/A	INTRINSIC
low complexity region	1289	1298	N/A	INTRINSIC
low complexity region	1338	1350	N/A	INTRINSIC
low complexity region	1366	1386	N/A	INTRINSIC
WD40	1502	1539	9.24e-4	SMART
WD40	1542	1584	1.83e-7	SMART
PQQ	1564	1595	3.42e2	SMART
WD40	1628	1668	3.45e-1	SMART
PQQ	1648	1679	9.14e1	SMART
WD40	1671	1708	2.12e-3	SMART
PQQ	1688	1719	6.42e0	SMART
WD40	1711	1748	6e-3	SMART
PQQ	1728	1759	5.7e2	SMART
WD40	1751	1788	3.58e-1	SMART
ZnF_C2H2	1795	1820	5.34e-1	SMART
ZnF_C2H2	1828	1856	1.31e2	SMART

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 98.2%
20x: 97.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit an abnormal gait, progressive motor deficits, kyphosis, weight loss, severe adult-onset degenerative sensory-motor axonopathy, mitochondrial dysfunction, and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg8	T	C	17: 84,691,821	L115P	probably damaging	Het
Adgrb3	A	C	1: 25,093,952	M481R	possibly damaging	Het
Adgrd1	C	A	5: 129,122,583	N161K	probably benign	Het
Alx4	T	A	2: 93,677,380	V340D	probably damaging	Het
Arid1a	A	G	4: 133,680,405	S2264P	unknown	Het
Azi2	A	T	9: 118,047,458	H14L	probably damaging	Het
Camsap2	A	G	1: 136,274,891		probably benign	Het
Ccpg1	T	A	9: 73,012,072	L323*	probably null	Het
Cpsf1	A	T	15: 76,598,948	I943N	probably damaging	Het
Crebrf	T	A	17: 26,759,765	Y476N	probably damaging	Het
Defb10	T	A	8: 21,861,878	Y46*	probably null	Het
Dock3	A	G	9: 106,986,070	L703P	probably damaging	Het
Ebf2	A	T	14: 67,247,069	I181F	probably damaging	Het
Eif3e	T	A	15: 43,251,521	M420L	probably benign	Het
Elmsan1	A	T	12: 84,152,887	F1020I	probably benign	Het
Emilin3	T	A	2: 160,909,265	Q188L	probably damaging	Het
Fbxl4	C	T	4: 22,376,840	T92M	probably damaging	Het
Fer1l6	C	T	15: 58,581,903	Q687*	probably null	Het
Fkrp	T	C	7: 16,810,710	E409G	possibly damaging	Het
Fzd9	T	C	5: 135,249,606	D475G	probably benign	Het
Gabbr1	C	T	17: 37,070,066	T767I	possibly damaging	Het
Gdf2	G	A	14: 33,941,494		probably null	Het
Gpatch1	T	C	7: 35,309,351	N82D	probably benign	Het
Heg1	T	A	16: 33,763,591	L1256Q	probably damaging	Het
Ireb2	T	A	9: 54,896,601		probably null	Het
Kansl1	T	G	11: 104,356,814	H570P	probably benign	Het
Kcna10	T	G	3: 107,194,428	M125R	probably damaging	Het
Lrp1b	T	G	2: 40,851,793	I3041L	possibly damaging	Het
Mbtd1	T	C	11: 93,924,648	F354S	possibly damaging	Het
Mov10	T	C	3: 104,802,578	T331A	probably benign	Het
Ms4a8a	A	T	19: 11,068,416	S243T	probably damaging	Het
Ndufa11	T	C	17: 56,717,867	S10P	probably benign	Het
Olfml3	A	G	3: 103,736,421	Y215H	possibly damaging	Het
Olfr315	T	A	11: 58,778,879	F251I	possibly damaging	Het
Olfr663	A	G	7: 104,704,322	I252V	possibly damaging	Het
Pclo	T	C	5: 14,713,560	S4016P	probably benign	Het
Pcyox1	G	C	6: 86,391,744	A264G	probably damaging	Het
Pdzrn3	C	T	6: 101,153,311	D515N	probably damaging	Het
Pnisr	A	G	4: 21,874,587		probably benign	Het
Prc1	T	C	7: 80,313,179	S574P	probably damaging	Het
Ranbp3l	T	A	15: 9,007,312	V16D	probably damaging	Het
Rfx1	T	C	8: 84,074,058	V96A	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sfmbt1	T	C	14: 30,815,254		probably null	Het
Siglecf	T	C	7: 43,351,940	Y111H	probably damaging	Het
Snx14	G	A	9: 88,398,294	T536I	possibly damaging	Het
Spindoc	A	G	19: 7,374,147	V204A	probably benign	Het
Sptbn5	A	G	2: 120,085,331		probably benign	Het
Swt1	G	A	1: 151,402,976	Q227*	probably null	Het
Tg	A	G	15: 66,759,567	I562V	possibly damaging	Het
Trip11	T	A	12: 101,884,920	I677F	probably damaging	Het
Vmn1r49	G	A	6: 90,072,771	T83I	probably benign	Het
Vmn1r90	T	C	7: 14,561,676	K166E	possibly damaging	Het
Vmn2r124	T	C	17: 18,049,557	I25T	possibly damaging	Het
Vps13d	A	T	4: 145,181,207		probably null	Het

Other mutations in Zfp106

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00330:Zfp106	APN	2	120539497	missense	probably benign	0.45
IGL00816:Zfp106	APN	2	120526848	missense	probably benign	0.02
IGL00822:Zfp106	APN	2	120514160	missense	probably damaging	1.00
IGL00848:Zfp106	APN	2	120512727	missense	probably damaging	1.00
IGL01293:Zfp106	APN	2	120535035	missense	possibly damaging	0.92
IGL01323:Zfp106	APN	2	120524464	missense	possibly damaging	0.74
IGL01662:Zfp106	APN	2	120523553	missense	probably benign	0.17
IGL01683:Zfp106	APN	2	120524555	missense	probably benign	0.00
IGL01809:Zfp106	APN	2	120533671	missense	probably damaging	1.00
IGL01958:Zfp106	APN	2	120534807	missense	probably benign	0.26
IGL01960:Zfp106	APN	2	120524043	missense	probably damaging	0.99
IGL01960:Zfp106	APN	2	120539322	missense	probably benign	0.08
IGL02168:Zfp106	APN	2	120534231	missense	possibly damaging	0.90
IGL02623:Zfp106	APN	2	120545914	splice site	probably null
IGL02798:Zfp106	APN	2	120510510	missense	probably damaging	1.00
IGL02828:Zfp106	APN	2	120531697	missense	possibly damaging	0.86
IGL03022:Zfp106	APN	2	120528639	splice site	probably benign
IGL03308:Zfp106	APN	2	120524024	missense	probably benign	0.00
IGL03324:Zfp106	APN	2	120535387	missense	probably benign	0.01
lepton	UTSW	2	120532104	missense	probably damaging	0.98
Proton	UTSW	2	120510534	missense	probably damaging	1.00
quark	UTSW	2	120535060	nonsense	probably null
R0040_zfp106_031	UTSW	2	120531613	missense	probably damaging	1.00
string	UTSW	2	120533594	missense	probably damaging	0.96
theory	UTSW	2	120533677	nonsense	probably null
R0040:Zfp106	UTSW	2	120531613	missense	probably damaging	1.00
R0040:Zfp106	UTSW	2	120531613	missense	probably damaging	1.00
R0135:Zfp106	UTSW	2	120520487	missense	probably damaging	0.99
R0180:Zfp106	UTSW	2	120533875	missense	probably damaging	0.96
R0387:Zfp106	UTSW	2	120528472	splice site	probably null
R0558:Zfp106	UTSW	2	120532196	missense	probably damaging	1.00
R0680:Zfp106	UTSW	2	120527016	missense	probably damaging	1.00
R0729:Zfp106	UTSW	2	120555248	missense	probably damaging	0.99
R0828:Zfp106	UTSW	2	120535603	missense	probably benign	0.00
R1124:Zfp106	UTSW	2	120534714	missense	probably benign	0.00
R1147:Zfp106	UTSW	2	120520536	missense	probably damaging	1.00
R1147:Zfp106	UTSW	2	120520536	missense	probably damaging	1.00
R1226:Zfp106	UTSW	2	120524079	missense	probably damaging	1.00
R1239:Zfp106	UTSW	2	120533594	missense	probably damaging	0.96
R1634:Zfp106	UTSW	2	120533677	nonsense	probably null
R1754:Zfp106	UTSW	2	120533763	missense	probably damaging	0.96
R1754:Zfp106	UTSW	2	120533764	missense	probably damaging	0.98
R1755:Zfp106	UTSW	2	120535175	missense	probably damaging	1.00
R1763:Zfp106	UTSW	2	120520428	missense	probably benign	0.03
R1875:Zfp106	UTSW	2	120513615	critical splice donor site	probably null
R1903:Zfp106	UTSW	2	120526848	missense	probably benign	0.02
R1932:Zfp106	UTSW	2	120531681	missense	possibly damaging	0.80
R2070:Zfp106	UTSW	2	120523529	missense	probably benign	0.11
R2301:Zfp106	UTSW	2	120535650	missense	probably benign	0.04
R3429:Zfp106	UTSW	2	120527063	missense	probably benign	0.00
R3720:Zfp106	UTSW	2	120534599	missense	probably benign	0.01
R3875:Zfp106	UTSW	2	120534613	missense	probably benign	0.08
R3881:Zfp106	UTSW	2	120532149	missense	probably benign	0.01
R3921:Zfp106	UTSW	2	120533616	missense	probably damaging	1.00
R3923:Zfp106	UTSW	2	120534856	missense	probably damaging	0.99
R4087:Zfp106	UTSW	2	120526899	splice site	probably null
R4678:Zfp106	UTSW	2	120533740	missense	probably damaging	1.00
R4965:Zfp106	UTSW	2	120533919	missense	probably damaging	0.98
R5011:Zfp106	UTSW	2	120510534	missense	probably damaging	1.00
R5013:Zfp106	UTSW	2	120510534	missense	probably damaging	1.00
R5151:Zfp106	UTSW	2	120534727	missense	probably benign	0.01
R5328:Zfp106	UTSW	2	120520417	missense	possibly damaging	0.73
R5403:Zfp106	UTSW	2	120534781	missense	probably benign	0.02
R5624:Zfp106	UTSW	2	120531957	missense	probably damaging	0.99
R5686:Zfp106	UTSW	2	120533507	splice site	probably null
R5691:Zfp106	UTSW	2	120524471	missense	probably damaging	0.99
R5852:Zfp106	UTSW	2	120516006	missense	probably damaging	1.00
R6032:Zfp106	UTSW	2	120535393	missense	probably benign	0.00
R6032:Zfp106	UTSW	2	120535393	missense	probably benign	0.00
R6298:Zfp106	UTSW	2	120522704	missense	probably damaging	1.00
R6409:Zfp106	UTSW	2	120532104	missense	probably damaging	0.98
R6505:Zfp106	UTSW	2	120534502	missense	probably damaging	0.99
R6598:Zfp106	UTSW	2	120535060	nonsense	probably null
R6765:Zfp106	UTSW	2	120539454	missense	probably damaging	0.96
R7013:Zfp106	UTSW	2	120531632	missense	probably damaging	0.99
R7453:Zfp106	UTSW	2	120510527	missense	probably damaging	1.00
R7453:Zfp106	UTSW	2	120545919	splice site	probably null
R7643:Zfp106	UTSW	2	120512734	missense	probably benign	0.01
R7829:Zfp106	UTSW	2	120524057	missense	possibly damaging	0.94
R7897:Zfp106	UTSW	2	120535615	nonsense	probably null
R7909:Zfp106	UTSW	2	120514219	missense	probably damaging	1.00
R8054:Zfp106	UTSW	2	120524519	missense	possibly damaging	0.93
R8124:Zfp106	UTSW	2	120524331	missense	probably benign	0.44
R8203:Zfp106	UTSW	2	120519078	missense	probably damaging	1.00
R8350:Zfp106	UTSW	2	120535618	missense
R8450:Zfp106	UTSW	2	120535618	missense
R8698:Zfp106	UTSW	2	120524119	critical splice donor site	probably null
R8985:Zfp106	UTSW	2	120535596	missense
R9015:Zfp106	UTSW	2	120533538	missense	probably damaging	1.00
R9036:Zfp106	UTSW	2	120539425	missense	probably damaging	1.00
R9142:Zfp106	UTSW	2	120520454	missense	probably damaging	1.00
R9154:Zfp106	UTSW	2	120534331	nonsense	probably null
R9175:Zfp106	UTSW	2	120522716	missense	probably damaging	1.00
R9529:Zfp106	UTSW	2	120520526	missense	probably damaging	0.97
R9572:Zfp106	UTSW	2	120519078	missense	probably damaging	1.00
R9581:Zfp106	UTSW	2	120535326	missense
RF008:Zfp106	UTSW	2	120524545	small deletion	probably benign
RF025:Zfp106	UTSW	2	120524545	small deletion	probably benign
X0025:Zfp106	UTSW	2	120534816	missense	probably benign
Z1088:Zfp106	UTSW	2	120530490	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGACTCCAAGAGCCAAGATTTATAAAG -3'
(R):5'- CAGGATGTGTTCACGGCTAAGC -3'

Sequencing Primer
(F):5'- CAGGAACACCATCCTTGTA -3'
(R):5'- CTAAGCCTGCAAGGAAGGTC -3'

Posted On

2016-07-22