Incidental Mutation 'R5227:Prc1'
ID402679
Institutional Source Beutler Lab
Gene Symbol Prc1
Ensembl Gene ENSMUSG00000038943
Gene Nameprotein regulator of cytokinesis 1
SynonymsD7Ertd348e
MMRRC Submission 042800-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5227 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location80294450-80316259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80313179 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 574 (S574P)
Ref Sequence ENSEMBL: ENSMUSP00000133387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047362] [ENSMUST00000047558] [ENSMUST00000121882] [ENSMUST00000163812] [ENSMUST00000172781] [ENSMUST00000173824] [ENSMUST00000174172] [ENSMUST00000174199]
Predicted Effect probably benign
Transcript: ENSMUST00000047362
SMART Domains Protein: ENSMUSP00000048043
Gene: ENSMUSG00000038930

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:RCC1 179 228 2.9e-17 PFAM
Pfam:RCC1_2 215 244 1.3e-10 PFAM
Pfam:RCC1 231 316 7.8e-9 PFAM
Pfam:RCC1_2 303 332 3.3e-10 PFAM
Pfam:RCC1 319 370 4.1e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000047558
AA Change: S571P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000043379
Gene: ENSMUSG00000038943
AA Change: S571P

DomainStartEndE-ValueType
internal_repeat_1 22 36 1.45e-5 PROSPERO
Pfam:MAP65_ASE1 37 602 5.3e-172 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121882
SMART Domains Protein: ENSMUSP00000113273
Gene: ENSMUSG00000038930

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:RCC1 179 228 7.4e-18 PFAM
Pfam:RCC1_2 216 244 5.5e-10 PFAM
Pfam:RCC1_2 304 332 6.2e-10 PFAM
Pfam:RCC1 319 370 1.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148001
Predicted Effect probably damaging
Transcript: ENSMUST00000163812
AA Change: S574P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129675
Gene: ENSMUSG00000038943
AA Change: S574P

DomainStartEndE-ValueType
internal_repeat_1 22 36 1.51e-5 PROSPERO
Pfam:MAP65_ASE1 37 605 1.9e-173 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172781
AA Change: S137P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133618
Gene: ENSMUSG00000038943
AA Change: S137P

DomainStartEndE-ValueType
Pfam:MAP65_ASE1 1 150 2.1e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172911
Predicted Effect probably benign
Transcript: ENSMUST00000173170
SMART Domains Protein: ENSMUSP00000133817
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
Pfam:MAP65_ASE1 1 189 2.1e-64 PFAM
Pfam:MAP65_ASE1 187 235 1.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173824
SMART Domains Protein: ENSMUSP00000133910
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
internal_repeat_1 22 36 8.71e-6 PROSPERO
Pfam:MAP65_ASE1 37 565 6e-168 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000174051
AA Change: S203P
SMART Domains Protein: ENSMUSP00000134262
Gene: ENSMUSG00000038943
AA Change: S203P

DomainStartEndE-ValueType
Pfam:MAP65_ASE1 1 244 1.9e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174111
Predicted Effect probably damaging
Transcript: ENSMUST00000174172
AA Change: S574P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133387
Gene: ENSMUSG00000038943
AA Change: S574P

DomainStartEndE-ValueType
Pfam:MAP65_ASE1 34 615 2.9e-167 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174199
SMART Domains Protein: ENSMUSP00000133295
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
Pfam:MAP65_ASE1 7 524 8.1e-158 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174599
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in cytokinesis. The protein is present at high levels during the S and G2/M phases of mitosis but its levels drop dramatically when the cell exits mitosis and enters the G1 phase. It is located in the nucleus during interphase, becomes associated with mitotic spindles in a highly dynamic manner during mitosis, and localizes to the cell mid-body during cytokinesis. This protein has been shown to be a substrate of several cyclin-dependent kinases (CDKs). It is necessary for polarizing parallel microtubules and concentrating the factors responsible for contractile ring assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T C 17: 84,691,821 L115P probably damaging Het
Adgrb3 A C 1: 25,093,952 M481R possibly damaging Het
Adgrd1 C A 5: 129,122,583 N161K probably benign Het
Alx4 T A 2: 93,677,380 V340D probably damaging Het
Arid1a A G 4: 133,680,405 S2264P unknown Het
Azi2 A T 9: 118,047,458 H14L probably damaging Het
Camsap2 A G 1: 136,274,891 probably benign Het
Ccpg1 T A 9: 73,012,072 L323* probably null Het
Cpsf1 A T 15: 76,598,948 I943N probably damaging Het
Crebrf T A 17: 26,759,765 Y476N probably damaging Het
Defb10 T A 8: 21,861,878 Y46* probably null Het
Dock3 A G 9: 106,986,070 L703P probably damaging Het
Ebf2 A T 14: 67,247,069 I181F probably damaging Het
Eif3e T A 15: 43,251,521 M420L probably benign Het
Elmsan1 A T 12: 84,152,887 F1020I probably benign Het
Emilin3 T A 2: 160,909,265 Q188L probably damaging Het
Fbxl4 C T 4: 22,376,840 T92M probably damaging Het
Fer1l6 C T 15: 58,581,903 Q687* probably null Het
Fkrp T C 7: 16,810,710 E409G possibly damaging Het
Fzd9 T C 5: 135,249,606 D475G probably benign Het
Gabbr1 C T 17: 37,070,066 T767I possibly damaging Het
Gdf2 G A 14: 33,941,494 probably null Het
Gpatch1 T C 7: 35,309,351 N82D probably benign Het
Heg1 T A 16: 33,763,591 L1256Q probably damaging Het
Ireb2 T A 9: 54,896,601 probably null Het
Kansl1 T G 11: 104,356,814 H570P probably benign Het
Kcna10 T G 3: 107,194,428 M125R probably damaging Het
Lrp1b T G 2: 40,851,793 I3041L possibly damaging Het
Mbtd1 T C 11: 93,924,648 F354S possibly damaging Het
Mov10 T C 3: 104,802,578 T331A probably benign Het
Ms4a8a A T 19: 11,068,416 S243T probably damaging Het
Ndufa11 T C 17: 56,717,867 S10P probably benign Het
Olfml3 A G 3: 103,736,421 Y215H possibly damaging Het
Olfr315 T A 11: 58,778,879 F251I possibly damaging Het
Olfr663 A G 7: 104,704,322 I252V possibly damaging Het
Pclo T C 5: 14,713,560 S4016P probably benign Het
Pcyox1 G C 6: 86,391,744 A264G probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Pnisr A G 4: 21,874,587 probably benign Het
Ranbp3l T A 15: 9,007,312 V16D probably damaging Het
Rfx1 T C 8: 84,074,058 V96A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfmbt1 T C 14: 30,815,254 probably null Het
Siglecf T C 7: 43,351,940 Y111H probably damaging Het
Snx14 G A 9: 88,398,294 T536I possibly damaging Het
Spindoc A G 19: 7,374,147 V204A probably benign Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Swt1 G A 1: 151,402,976 Q227* probably null Het
Tg A G 15: 66,759,567 I562V possibly damaging Het
Trip11 T A 12: 101,884,920 I677F probably damaging Het
Vmn1r49 G A 6: 90,072,771 T83I probably benign Het
Vmn1r90 T C 7: 14,561,676 K166E possibly damaging Het
Vmn2r124 T C 17: 18,049,557 I25T possibly damaging Het
Vps13d A T 4: 145,181,207 probably null Het
Zfp106 T C 2: 120,523,968 I170V probably benign Het
Other mutations in Prc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Prc1 APN 7 80307696 critical splice donor site probably null
IGL02342:Prc1 APN 7 80309442 missense probably damaging 1.00
IGL03058:Prc1 APN 7 80301125 missense probably benign 0.05
R0026:Prc1 UTSW 7 80311061 unclassified probably benign
R0315:Prc1 UTSW 7 80313536 missense probably damaging 0.99
R0453:Prc1 UTSW 7 80313102 missense probably damaging 1.00
R2101:Prc1 UTSW 7 80312284 missense probably benign 0.38
R2857:Prc1 UTSW 7 80312221 missense probably damaging 0.99
R4237:Prc1 UTSW 7 80311216 unclassified probably benign
R4238:Prc1 UTSW 7 80311216 unclassified probably benign
R4240:Prc1 UTSW 7 80311216 unclassified probably benign
R4300:Prc1 UTSW 7 80311216 unclassified probably benign
R4745:Prc1 UTSW 7 80313163 missense probably benign 0.10
R5574:Prc1 UTSW 7 80294542 unclassified probably benign
R6174:Prc1 UTSW 7 80304796 missense probably benign 0.02
R6269:Prc1 UTSW 7 80309427 missense probably damaging 0.99
R7060:Prc1 UTSW 7 80304373 missense probably benign 0.00
R7201:Prc1 UTSW 7 80311089 missense possibly damaging 0.65
R7266:Prc1 UTSW 7 80307657 missense possibly damaging 0.78
R7491:Prc1 UTSW 7 80309491 splice site probably null
R7498:Prc1 UTSW 7 80313150 missense possibly damaging 0.83
R7528:Prc1 UTSW 7 80300435 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCAATACAAATGCAGTGTCAGG -3'
(R):5'- CCCAACATGATCAAGGCATG -3'

Sequencing Primer
(F):5'- ACAAATGCAGTGTCAGGGTTTC -3'
(R):5'- GCATGAAAGGGATTCTCAGCCC -3'
Posted On2016-07-22