Incidental Mutation 'R0415:Dip2c'
ID 40269
Institutional Source Beutler Lab
Gene Symbol Dip2c
Ensembl Gene ENSMUSG00000048264
Gene Name disco interacting protein 2 homolog C
Synonyms 2900024P20Rik
MMRRC Submission 038617-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.590) question?
Stock # R0415 (G1)
Quality Score 126
Status Validated
Chromosome 13
Chromosomal Location 9326564-9718964 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to T at 9618325 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552]
AlphaFold E9PWR4
Predicted Effect probably benign
Transcript: ENSMUST00000166299
SMART Domains Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 801 3.6e-23 PFAM
Pfam:AMP-binding 977 1451 1.5e-72 PFAM
low complexity region 1514 1526 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169960
SMART Domains Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264

DomainStartEndE-ValueType
DMAP_binding 7 176 3.02e-37 SMART
low complexity region 226 243 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
Pfam:AMP-binding 380 637 5.9e-10 PFAM
SCOP:d1lci__ 675 875 2e-8 SMART
Pfam:AMP-binding 947 1421 1.2e-56 PFAM
low complexity region 1484 1496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174552
SMART Domains Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 800 2.7e-20 PFAM
Pfam:AMP-binding 976 1450 1.3e-56 PFAM
low complexity region 1513 1525 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (99/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427G23Rik A T 5: 24,036,048 (GRCm39) noncoding transcript Het
Acox2 A G 14: 8,243,835 (GRCm38) probably benign Het
Adgb T C 10: 10,306,811 (GRCm39) probably null Het
Adgra3 C A 5: 50,119,099 (GRCm39) probably benign Het
Adgre4 G A 17: 56,159,288 (GRCm39) V658I probably benign Het
Ahnak A G 19: 8,990,235 (GRCm39) probably benign Het
Anapc2 A G 2: 25,168,337 (GRCm39) T159A probably damaging Het
Arfgef3 A G 10: 18,488,875 (GRCm39) probably benign Het
Atf7ip C T 6: 136,537,010 (GRCm39) S81L possibly damaging Het
Cacna1i A G 15: 80,253,031 (GRCm39) probably benign Het
Camk1 A T 6: 113,318,852 (GRCm39) Y20* probably null Het
Ccdc40 T C 11: 119,122,944 (GRCm39) Y249H possibly damaging Het
Cd109 T A 9: 78,619,897 (GRCm39) S1380T probably benign Het
Cfap57 A T 4: 118,426,628 (GRCm39) L1107Q possibly damaging Het
Col6a4 C T 9: 105,952,279 (GRCm39) V540I probably damaging Het
Cst9 T A 2: 148,680,362 (GRCm39) probably benign Het
Cul5 C T 9: 53,578,370 (GRCm39) V73I probably benign Het
Cxcl16 T A 11: 70,349,574 (GRCm39) K84* probably null Het
Cyp2c29 T C 19: 39,317,539 (GRCm39) probably benign Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Het
Dis3 A T 14: 99,324,892 (GRCm39) I513N probably damaging Het
Dnajc16 A T 4: 141,516,359 (GRCm39) L3* probably null Het
Dop1a T A 9: 86,388,555 (GRCm39) L480M probably damaging Het
Eml6 A G 11: 29,699,392 (GRCm39) V1787A possibly damaging Het
Etnk1 A G 6: 143,126,500 (GRCm39) N115S probably damaging Het
Fryl T C 5: 73,255,757 (GRCm39) Y758C probably damaging Het
Gbp4 G A 5: 105,268,972 (GRCm39) R394C possibly damaging Het
Ggnbp2 A C 11: 84,724,051 (GRCm39) probably benign Het
Gm7137 A G 10: 77,624,007 (GRCm39) probably benign Het
Gstm2 T A 3: 107,891,322 (GRCm39) Q132L probably benign Het
Habp2 T C 19: 56,306,149 (GRCm39) probably benign Het
Hectd2 T C 19: 36,562,284 (GRCm39) probably benign Het
Htr6 A G 4: 138,789,392 (GRCm39) I291T possibly damaging Het
Ighg2c T C 12: 113,251,530 (GRCm39) D199G unknown Het
Itih2 A G 2: 10,110,426 (GRCm39) probably benign Het
Kcnab2 A G 4: 152,479,593 (GRCm39) F248S probably benign Het
Kcnc4 T C 3: 107,352,749 (GRCm39) K610E probably damaging Het
Kcnk16 T A 14: 20,313,043 (GRCm39) probably null Het
Kndc1 C T 7: 139,510,037 (GRCm39) T1293I probably damaging Het
Lcp1 A T 14: 75,464,446 (GRCm39) I556F possibly damaging Het
Lrrc8d T C 5: 105,959,731 (GRCm39) L47P probably damaging Het
Lyset T A 12: 102,711,135 (GRCm39) Y119* probably null Het
Lyst T C 13: 13,886,195 (GRCm39) probably benign Het
Macrod2 G A 2: 142,052,065 (GRCm39) probably null Het
Mical2 C T 7: 111,980,235 (GRCm39) R70C probably damaging Het
Mllt3 ACTGCTGCTGCTGCTGCTGCT ACTGCTGCTGCTGCTGCT 4: 87,759,576 (GRCm39) probably benign Het
Msh3 A G 13: 92,483,294 (GRCm39) V283A possibly damaging Het
Nup205 T C 6: 35,191,569 (GRCm39) probably benign Het
Nxpe2 T C 9: 48,237,914 (GRCm39) T114A probably damaging Het
Or51e2 C T 7: 102,391,294 (GRCm39) M305I probably benign Het
Or5m10 A T 2: 85,717,782 (GRCm39) I213F possibly damaging Het
Or5m9 A T 2: 85,877,399 (GRCm39) H191L probably benign Het
Or8c15 A T 9: 38,121,269 (GRCm39) M305L probably benign Het
Or8g2 A G 9: 39,821,279 (GRCm39) Y60C probably damaging Het
Pard3 G A 8: 128,337,047 (GRCm39) G1221D probably damaging Het
Pax5 G A 4: 44,691,886 (GRCm39) A120V probably damaging Het
Pcsk6 C T 7: 65,683,622 (GRCm39) R746C probably damaging Het
Pif1 G A 9: 65,495,333 (GRCm39) C81Y probably benign Het
Plcb1 A G 2: 135,179,419 (GRCm39) Y609C probably damaging Het
Plcd4 C A 1: 74,591,256 (GRCm39) S217Y probably damaging Het
Plxna1 G A 6: 89,334,318 (GRCm39) H104Y probably benign Het
Polr2k A G 15: 36,175,602 (GRCm39) Y45C probably damaging Het
Prex1 A G 2: 166,428,619 (GRCm39) probably benign Het
Pth2r A G 1: 65,427,598 (GRCm39) M424V probably benign Het
Pygm A G 19: 6,441,396 (GRCm39) R464G probably benign Het
Rad51c A G 11: 87,288,481 (GRCm39) L234P probably damaging Het
Rnf145 A G 11: 44,415,965 (GRCm39) Y60C probably damaging Het
Rnf167 T C 11: 70,540,525 (GRCm39) I135T probably damaging Het
Rnf213 A T 11: 119,305,295 (GRCm39) I509F probably damaging Het
Ro60 G T 1: 143,635,813 (GRCm39) N444K probably benign Het
Ryr2 T C 13: 11,884,042 (GRCm39) S213G probably damaging Het
Selenbp1 T C 3: 94,844,224 (GRCm39) V27A possibly damaging Het
Selenof T G 3: 144,283,453 (GRCm39) L14R probably damaging Het
Sfswap A T 5: 129,581,190 (GRCm39) D121V probably damaging Het
Slc25a34 C A 4: 141,347,780 (GRCm39) M300I possibly damaging Het
Slc34a3 T G 2: 25,119,122 (GRCm39) T583P probably benign Het
Slc66a3 C A 12: 17,047,711 (GRCm39) probably benign Het
Smg1 C A 7: 117,781,691 (GRCm39) A1199S probably benign Het
Spint1 A G 2: 119,076,096 (GRCm39) T231A probably damaging Het
Sptbn1 A C 11: 30,099,576 (GRCm39) N229K probably damaging Het
Sult2b1 A G 7: 45,379,516 (GRCm39) probably benign Het
Tas2r123 A T 6: 132,824,801 (GRCm39) M233L probably damaging Het
Tbcel C A 9: 42,355,796 (GRCm39) C139F probably benign Het
Thbs2 A C 17: 14,900,235 (GRCm39) S573A probably benign Het
Tmem132c A G 5: 127,640,769 (GRCm39) E980G probably damaging Het
Tmem247 G T 17: 87,229,750 (GRCm39) C197F probably damaging Het
Tmem43 C A 6: 91,459,300 (GRCm39) P257Q probably benign Het
Tmprss13 A G 9: 45,248,430 (GRCm39) probably null Het
Ubr5 T C 15: 37,973,224 (GRCm39) T2626A probably damaging Het
Vmn1r196 T A 13: 22,478,006 (GRCm39) V215D probably damaging Het
Vmn1r22 G T 6: 57,877,317 (GRCm39) T220K probably benign Het
Vmn2r116 G A 17: 23,606,253 (GRCm39) M388I possibly damaging Het
Vmn2r74 A C 7: 85,610,618 (GRCm39) C25G probably damaging Het
Xndc1 T C 7: 101,729,823 (GRCm39) probably benign Het
Zfp282 A G 6: 47,874,815 (GRCm39) D340G probably damaging Het
Zfp282 T A 6: 47,881,987 (GRCm39) I558N possibly damaging Het
Zfp316 T A 5: 143,250,246 (GRCm39) T56S unknown Het
Zfp345 A G 2: 150,316,479 (GRCm39) probably benign Het
Other mutations in Dip2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Dip2c APN 13 9,543,144 (GRCm39) missense probably damaging 0.97
IGL00426:Dip2c APN 13 9,656,551 (GRCm39) missense probably damaging 1.00
IGL00503:Dip2c APN 13 9,617,934 (GRCm39) missense probably damaging 1.00
IGL00586:Dip2c APN 13 9,660,791 (GRCm39) missense probably damaging 1.00
IGL01306:Dip2c APN 13 9,625,179 (GRCm39) missense possibly damaging 0.72
IGL01580:Dip2c APN 13 9,687,124 (GRCm39) splice site probably null
IGL01985:Dip2c APN 13 9,603,303 (GRCm39) splice site probably benign
IGL02060:Dip2c APN 13 9,672,666 (GRCm39) missense probably damaging 0.98
IGL02122:Dip2c APN 13 9,556,695 (GRCm39) missense possibly damaging 0.48
IGL02170:Dip2c APN 13 9,656,371 (GRCm39) missense probably benign 0.03
IGL02211:Dip2c APN 13 9,660,883 (GRCm39) missense probably damaging 1.00
IGL02755:Dip2c APN 13 9,600,356 (GRCm39) critical splice donor site probably null
IGL02836:Dip2c APN 13 9,660,826 (GRCm39) missense probably damaging 0.98
IGL02935:Dip2c APN 13 9,712,182 (GRCm39) missense probably damaging 1.00
IGL03032:Dip2c APN 13 9,601,814 (GRCm39) missense probably damaging 1.00
ANU23:Dip2c UTSW 13 9,625,179 (GRCm39) missense possibly damaging 0.72
P0038:Dip2c UTSW 13 9,697,018 (GRCm39) missense probably damaging 1.00
R0009:Dip2c UTSW 13 9,671,939 (GRCm39) missense probably damaging 1.00
R0268:Dip2c UTSW 13 9,687,186 (GRCm39) missense probably damaging 1.00
R0271:Dip2c UTSW 13 9,665,811 (GRCm39) missense probably damaging 1.00
R0306:Dip2c UTSW 13 9,654,635 (GRCm39) missense probably benign 0.09
R0519:Dip2c UTSW 13 9,613,244 (GRCm39) missense probably damaging 1.00
R0557:Dip2c UTSW 13 9,603,495 (GRCm39) missense possibly damaging 0.81
R0964:Dip2c UTSW 13 9,618,699 (GRCm39) missense probably benign 0.43
R0973:Dip2c UTSW 13 9,626,944 (GRCm39) missense probably damaging 0.99
R0973:Dip2c UTSW 13 9,626,944 (GRCm39) missense probably damaging 0.99
R0974:Dip2c UTSW 13 9,626,944 (GRCm39) missense probably damaging 0.99
R1101:Dip2c UTSW 13 9,684,780 (GRCm39) missense probably damaging 1.00
R1171:Dip2c UTSW 13 9,543,162 (GRCm39) missense possibly damaging 0.89
R1403:Dip2c UTSW 13 9,603,300 (GRCm39) splice site probably null
R1403:Dip2c UTSW 13 9,603,300 (GRCm39) splice site probably null
R1432:Dip2c UTSW 13 9,603,340 (GRCm39) missense probably damaging 0.99
R1481:Dip2c UTSW 13 9,601,902 (GRCm39) critical splice donor site probably null
R1588:Dip2c UTSW 13 9,715,900 (GRCm39) missense probably damaging 1.00
R1721:Dip2c UTSW 13 9,709,404 (GRCm39) missense probably damaging 1.00
R1726:Dip2c UTSW 13 9,625,464 (GRCm39) missense probably damaging 1.00
R1867:Dip2c UTSW 13 9,671,985 (GRCm39) missense possibly damaging 0.55
R1909:Dip2c UTSW 13 9,583,386 (GRCm39) missense probably benign 0.00
R2013:Dip2c UTSW 13 9,617,882 (GRCm39) nonsense probably null
R2022:Dip2c UTSW 13 9,601,836 (GRCm39) missense probably damaging 1.00
R2517:Dip2c UTSW 13 9,659,041 (GRCm39) missense probably damaging 1.00
R3746:Dip2c UTSW 13 9,651,509 (GRCm39) missense probably damaging 1.00
R3794:Dip2c UTSW 13 9,654,597 (GRCm39) missense probably damaging 0.99
R3884:Dip2c UTSW 13 9,601,894 (GRCm39) missense probably damaging 1.00
R4019:Dip2c UTSW 13 9,664,401 (GRCm39) missense probably damaging 0.99
R4110:Dip2c UTSW 13 9,687,137 (GRCm39) missense probably damaging 1.00
R4111:Dip2c UTSW 13 9,687,137 (GRCm39) missense probably damaging 1.00
R4113:Dip2c UTSW 13 9,687,137 (GRCm39) missense probably damaging 1.00
R4256:Dip2c UTSW 13 9,659,092 (GRCm39) missense probably damaging 1.00
R4300:Dip2c UTSW 13 9,660,747 (GRCm39) missense probably damaging 1.00
R4494:Dip2c UTSW 13 9,621,098 (GRCm39) missense possibly damaging 0.64
R4739:Dip2c UTSW 13 9,583,375 (GRCm39) missense probably damaging 0.98
R4812:Dip2c UTSW 13 9,687,166 (GRCm39) nonsense probably null
R4814:Dip2c UTSW 13 9,586,896 (GRCm39) missense probably benign 0.07
R4816:Dip2c UTSW 13 9,625,186 (GRCm39) missense probably benign 0.37
R4828:Dip2c UTSW 13 9,610,715 (GRCm39) missense probably damaging 1.00
R4915:Dip2c UTSW 13 9,671,905 (GRCm39) splice site probably null
R4917:Dip2c UTSW 13 9,671,905 (GRCm39) splice site probably null
R4932:Dip2c UTSW 13 9,674,008 (GRCm39) missense probably damaging 0.99
R4993:Dip2c UTSW 13 9,625,259 (GRCm39) nonsense probably null
R5043:Dip2c UTSW 13 9,601,863 (GRCm39) missense possibly damaging 0.80
R5349:Dip2c UTSW 13 9,672,689 (GRCm39) missense probably damaging 1.00
R5744:Dip2c UTSW 13 9,618,441 (GRCm39) missense probably damaging 1.00
R5840:Dip2c UTSW 13 9,556,712 (GRCm39) missense possibly damaging 0.68
R6110:Dip2c UTSW 13 9,673,802 (GRCm39) missense probably damaging 1.00
R6160:Dip2c UTSW 13 9,583,290 (GRCm39) missense probably benign 0.01
R6161:Dip2c UTSW 13 9,697,043 (GRCm39) missense probably damaging 1.00
R6477:Dip2c UTSW 13 9,673,796 (GRCm39) missense probably damaging 1.00
R6522:Dip2c UTSW 13 9,625,264 (GRCm39) critical splice donor site probably null
R6603:Dip2c UTSW 13 9,704,624 (GRCm39) splice site probably null
R6658:Dip2c UTSW 13 9,543,213 (GRCm39) critical splice donor site probably null
R6672:Dip2c UTSW 13 9,617,866 (GRCm39) critical splice acceptor site probably null
R6697:Dip2c UTSW 13 9,671,949 (GRCm39) missense probably damaging 1.00
R6991:Dip2c UTSW 13 9,684,868 (GRCm39) missense probably damaging 1.00
R6991:Dip2c UTSW 13 9,601,896 (GRCm39) nonsense probably null
R7018:Dip2c UTSW 13 9,709,314 (GRCm39) missense probably damaging 1.00
R7053:Dip2c UTSW 13 9,660,740 (GRCm39) missense probably damaging 1.00
R7102:Dip2c UTSW 13 9,654,572 (GRCm39) missense probably benign 0.01
R7171:Dip2c UTSW 13 9,556,684 (GRCm39) missense probably benign 0.34
R7371:Dip2c UTSW 13 9,642,785 (GRCm39) missense probably benign 0.02
R7395:Dip2c UTSW 13 9,664,413 (GRCm39) missense probably damaging 1.00
R7489:Dip2c UTSW 13 9,583,348 (GRCm39) missense probably damaging 0.99
R7575:Dip2c UTSW 13 9,678,048 (GRCm39) missense probably damaging 0.97
R7642:Dip2c UTSW 13 9,672,741 (GRCm39) critical splice donor site probably null
R7687:Dip2c UTSW 13 9,654,617 (GRCm39) missense probably benign 0.00
R7699:Dip2c UTSW 13 9,709,347 (GRCm39) missense probably benign 0.00
R7700:Dip2c UTSW 13 9,709,347 (GRCm39) missense probably benign 0.00
R7715:Dip2c UTSW 13 9,664,427 (GRCm39) missense probably damaging 1.00
R7842:Dip2c UTSW 13 9,656,569 (GRCm39) critical splice donor site probably null
R7845:Dip2c UTSW 13 9,659,080 (GRCm39) missense probably damaging 1.00
R8354:Dip2c UTSW 13 9,671,918 (GRCm39) missense probably benign 0.05
R8685:Dip2c UTSW 13 9,687,161 (GRCm39) missense probably benign 0.01
R8779:Dip2c UTSW 13 9,660,845 (GRCm39) missense probably damaging 0.98
R8786:Dip2c UTSW 13 9,665,830 (GRCm39) missense probably damaging 0.99
R8815:Dip2c UTSW 13 9,673,834 (GRCm39) nonsense probably null
R8833:Dip2c UTSW 13 9,625,519 (GRCm39) critical splice donor site probably null
R8868:Dip2c UTSW 13 9,625,503 (GRCm39) missense possibly damaging 0.73
R8873:Dip2c UTSW 13 9,625,182 (GRCm39) missense probably benign 0.03
R8887:Dip2c UTSW 13 9,673,989 (GRCm39) splice site probably benign
R8923:Dip2c UTSW 13 9,673,901 (GRCm39) missense probably damaging 1.00
R9112:Dip2c UTSW 13 9,660,766 (GRCm39) missense probably damaging 1.00
R9424:Dip2c UTSW 13 9,709,431 (GRCm39) missense probably damaging 1.00
R9474:Dip2c UTSW 13 9,544,963 (GRCm39) missense unknown
R9527:Dip2c UTSW 13 9,544,875 (GRCm39) missense unknown
R9593:Dip2c UTSW 13 9,704,683 (GRCm39) missense possibly damaging 0.89
R9615:Dip2c UTSW 13 9,625,191 (GRCm39) missense probably benign 0.03
R9801:Dip2c UTSW 13 9,626,936 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCTGTCACAAAGGACTGCC -3'
(R):5'- ATACACTCCCAGCCTCTGTGGAAG -3'

Sequencing Primer
(F):5'- CAGAACTGTCCTATTGAGTCAGG -3'
(R):5'- TGTGGAAGGCATCCACCTTAC -3'
Posted On 2013-05-23