Incidental Mutation 'R5227:Ebf2'
ID402698
Institutional Source Beutler Lab
Gene Symbol Ebf2
Ensembl Gene ENSMUSG00000022053
Gene Nameearly B cell factor 2
SynonymsMmot1, D14Ggc1e, O/E-3
MMRRC Submission 042800-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.820) question?
Stock #R5227 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location67233292-67430918 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67247069 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 181 (I181F)
Ref Sequence ENSEMBL: ENSMUSP00000135500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022637] [ENSMUST00000176029] [ENSMUST00000176161]
Predicted Effect probably damaging
Transcript: ENSMUST00000022637
AA Change: I181F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022637
Gene: ENSMUSG00000022053
AA Change: I181F

DomainStartEndE-ValueType
IPT 252 336 9.09e-8 SMART
HLH 337 386 3.39e-1 SMART
internal_repeat_1 388 412 2.68e-6 PROSPERO
low complexity region 454 484 N/A INTRINSIC
low complexity region 512 531 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176029
AA Change: I181F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135782
Gene: ENSMUSG00000022053
AA Change: I181F

DomainStartEndE-ValueType
Pfam:COE1_DBD 16 246 2.3e-145 PFAM
IPT 252 336 9.09e-8 SMART
HLH 337 386 3.39e-1 SMART
internal_repeat_1 388 412 2.68e-6 PROSPERO
low complexity region 454 484 N/A INTRINSIC
low complexity region 512 531 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176161
AA Change: I181F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135500
Gene: ENSMUSG00000022053
AA Change: I181F

DomainStartEndE-ValueType
IPT 252 336 9.09e-8 SMART
HLH 337 386 3.39e-1 SMART
internal_repeat_1 388 412 2.68e-6 PROSPERO
low complexity region 454 484 N/A INTRINSIC
low complexity region 512 531 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the COE (Collier/Olf/EBF) family of non-basic, helix-loop-helix transcription factors that have a well conserved DNA binding domain. The COE family proteins play an important role in variety of developmental processes. Studies in mouse suggest that this gene may be involved in the differentiation of osteoblasts. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mutants show decreased viability, impaired olfactory neuron projection, and impaired mating, more so in male mice. Mice homozygous for another knock-out allele exhibit narcolepsy-cataplexy syndrome and decreased orexinergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T C 17: 84,691,821 L115P probably damaging Het
Adgrb3 A C 1: 25,093,952 M481R possibly damaging Het
Adgrd1 C A 5: 129,122,583 N161K probably benign Het
Alx4 T A 2: 93,677,380 V340D probably damaging Het
Arid1a A G 4: 133,680,405 S2264P unknown Het
Azi2 A T 9: 118,047,458 H14L probably damaging Het
Camsap2 A G 1: 136,274,891 probably benign Het
Ccpg1 T A 9: 73,012,072 L323* probably null Het
Cpsf1 A T 15: 76,598,948 I943N probably damaging Het
Crebrf T A 17: 26,759,765 Y476N probably damaging Het
Defb10 T A 8: 21,861,878 Y46* probably null Het
Dock3 A G 9: 106,986,070 L703P probably damaging Het
Eif3e T A 15: 43,251,521 M420L probably benign Het
Elmsan1 A T 12: 84,152,887 F1020I probably benign Het
Emilin3 T A 2: 160,909,265 Q188L probably damaging Het
Fbxl4 C T 4: 22,376,840 T92M probably damaging Het
Fer1l6 C T 15: 58,581,903 Q687* probably null Het
Fkrp T C 7: 16,810,710 E409G possibly damaging Het
Fzd9 T C 5: 135,249,606 D475G probably benign Het
Gabbr1 C T 17: 37,070,066 T767I possibly damaging Het
Gdf2 G A 14: 33,941,494 probably null Het
Gpatch1 T C 7: 35,309,351 N82D probably benign Het
Heg1 T A 16: 33,763,591 L1256Q probably damaging Het
Ireb2 T A 9: 54,896,601 probably null Het
Kansl1 T G 11: 104,356,814 H570P probably benign Het
Kcna10 T G 3: 107,194,428 M125R probably damaging Het
Lrp1b T G 2: 40,851,793 I3041L possibly damaging Het
Mbtd1 T C 11: 93,924,648 F354S possibly damaging Het
Mov10 T C 3: 104,802,578 T331A probably benign Het
Ms4a8a A T 19: 11,068,416 S243T probably damaging Het
Ndufa11 T C 17: 56,717,867 S10P probably benign Het
Olfml3 A G 3: 103,736,421 Y215H possibly damaging Het
Olfr315 T A 11: 58,778,879 F251I possibly damaging Het
Olfr663 A G 7: 104,704,322 I252V possibly damaging Het
Pclo T C 5: 14,713,560 S4016P probably benign Het
Pcyox1 G C 6: 86,391,744 A264G probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Pnisr A G 4: 21,874,587 probably benign Het
Prc1 T C 7: 80,313,179 S574P probably damaging Het
Ranbp3l T A 15: 9,007,312 V16D probably damaging Het
Rfx1 T C 8: 84,074,058 V96A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfmbt1 T C 14: 30,815,254 probably null Het
Siglecf T C 7: 43,351,940 Y111H probably damaging Het
Snx14 G A 9: 88,398,294 T536I possibly damaging Het
Spindoc A G 19: 7,374,147 V204A probably benign Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Swt1 G A 1: 151,402,976 Q227* probably null Het
Tg A G 15: 66,759,567 I562V possibly damaging Het
Trip11 T A 12: 101,884,920 I677F probably damaging Het
Vmn1r49 G A 6: 90,072,771 T83I probably benign Het
Vmn1r90 T C 7: 14,561,676 K166E possibly damaging Het
Vmn2r124 T C 17: 18,049,557 I25T possibly damaging Het
Vps13d A T 4: 145,181,207 probably null Het
Zfp106 T C 2: 120,523,968 I170V probably benign Het
Other mutations in Ebf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Ebf2 APN 14 67239478 missense probably damaging 1.00
IGL01808:Ebf2 APN 14 67414483 missense probably benign 0.01
IGL02087:Ebf2 APN 14 67428096 missense probably benign 0.03
IGL02094:Ebf2 APN 14 67235240 missense possibly damaging 0.80
IGL02270:Ebf2 APN 14 67238953 missense probably damaging 1.00
IGL03222:Ebf2 APN 14 67411992 splice site probably null
IGL03390:Ebf2 APN 14 67424109 missense probably benign 0.19
R0044:Ebf2 UTSW 14 67310968 intron probably benign
R0062:Ebf2 UTSW 14 67238540 splice site probably benign
R0062:Ebf2 UTSW 14 67238540 splice site probably benign
R0069:Ebf2 UTSW 14 67410050 missense probably damaging 0.99
R0069:Ebf2 UTSW 14 67410050 missense probably damaging 0.99
R0505:Ebf2 UTSW 14 67371736 nonsense probably null
R2103:Ebf2 UTSW 14 67387942 missense probably damaging 1.00
R2438:Ebf2 UTSW 14 67387942 missense probably damaging 1.00
R3789:Ebf2 UTSW 14 67239493 critical splice donor site probably null
R4153:Ebf2 UTSW 14 67235223 missense probably damaging 1.00
R4348:Ebf2 UTSW 14 67239422 missense probably damaging 0.99
R4793:Ebf2 UTSW 14 67410082 missense probably damaging 1.00
R4991:Ebf2 UTSW 14 67389657 missense possibly damaging 0.87
R5164:Ebf2 UTSW 14 67390521 missense possibly damaging 0.94
R5222:Ebf2 UTSW 14 67313594 intron probably benign
R5459:Ebf2 UTSW 14 67235201 missense probably benign 0.34
R5622:Ebf2 UTSW 14 67390558 missense possibly damaging 0.91
R6035:Ebf2 UTSW 14 67238974 missense probably damaging 1.00
R6035:Ebf2 UTSW 14 67238974 missense probably damaging 1.00
R6265:Ebf2 UTSW 14 67424060 missense probably benign 0.00
R6893:Ebf2 UTSW 14 67237559 missense probably benign 0.22
R7078:Ebf2 UTSW 14 67423958 missense probably benign
R7394:Ebf2 UTSW 14 67237526 missense probably damaging 0.99
R7449:Ebf2 UTSW 14 67410020 missense probably damaging 0.99
R7652:Ebf2 UTSW 14 67390567 critical splice donor site probably null
R7724:Ebf2 UTSW 14 67424040 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCAGCTTCAGATTGAGGG -3'
(R):5'- AGACATCGCCAACATGAGG -3'

Sequencing Primer
(F):5'- TGATGCAGCTTGGGGTCCC -3'
(R):5'- GGAAATCCTGGCTGCAGG -3'
Posted On2016-07-22