Incidental Mutation 'R5227:Gabbr1'
ID402707
Institutional Source Beutler Lab
Gene Symbol Gabbr1
Ensembl Gene ENSMUSG00000024462
Gene Namegamma-aminobutyric acid (GABA) B receptor, 1
SynonymsGABAB1, GABAbR1
MMRRC Submission 042800-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.675) question?
Stock #R5227 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37045966-37075067 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 37070066 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 767 (T767I)
Ref Sequence ENSEMBL: ENSMUSP00000025338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025338] [ENSMUST00000172792] [ENSMUST00000173823]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025338
AA Change: T767I

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025338
Gene: ENSMUSG00000024462
AA Change: T767I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CCP 29 95 8.72e0 SMART
CCP 99 156 3.03e-10 SMART
Pfam:Peripla_BP_6 168 538 1.6e-23 PFAM
Pfam:ANF_receptor 186 542 4.3e-73 PFAM
Pfam:7tm_3 602 858 9.8e-49 PFAM
coiled coil region 877 922 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172792
AA Change: T651I

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000134268
Gene: ENSMUSG00000024462
AA Change: T651I

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 30 51 N/A INTRINSIC
Pfam:Peripla_BP_6 52 428 7.8e-24 PFAM
Pfam:ANF_receptor 70 426 5.7e-68 PFAM
Pfam:7tm_3 484 743 1.1e-50 PFAM
coiled coil region 761 806 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173823
SMART Domains Protein: ENSMUSP00000133797
Gene: ENSMUSG00000024462

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sushi 29 95 1.6e-6 PFAM
low complexity region 159 176 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174071
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for gamma-aminobutyric acid (GABA), which is the main inhibitory neurotransmitter in the mammalian central nervous system. This receptor functions as a heterodimer with GABA(B) receptor 2. Defects in this gene may underlie brain disorders such as schizophrenia and epilepsy. Alternative splicing generates multiple transcript variants, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jan 2016]
PHENOTYPE: Phenotypes of null mice vary depending on strain background and allele. Homozygous null mice may display seizures, premature death, and abnormal nervous system electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T C 17: 84,691,821 L115P probably damaging Het
Adgrb3 A C 1: 25,093,952 M481R possibly damaging Het
Adgrd1 C A 5: 129,122,583 N161K probably benign Het
Alx4 T A 2: 93,677,380 V340D probably damaging Het
Arid1a A G 4: 133,680,405 S2264P unknown Het
Azi2 A T 9: 118,047,458 H14L probably damaging Het
Camsap2 A G 1: 136,274,891 probably benign Het
Ccpg1 T A 9: 73,012,072 L323* probably null Het
Cpsf1 A T 15: 76,598,948 I943N probably damaging Het
Crebrf T A 17: 26,759,765 Y476N probably damaging Het
Defb10 T A 8: 21,861,878 Y46* probably null Het
Dock3 A G 9: 106,986,070 L703P probably damaging Het
Ebf2 A T 14: 67,247,069 I181F probably damaging Het
Eif3e T A 15: 43,251,521 M420L probably benign Het
Elmsan1 A T 12: 84,152,887 F1020I probably benign Het
Emilin3 T A 2: 160,909,265 Q188L probably damaging Het
Fbxl4 C T 4: 22,376,840 T92M probably damaging Het
Fer1l6 C T 15: 58,581,903 Q687* probably null Het
Fkrp T C 7: 16,810,710 E409G possibly damaging Het
Fzd9 T C 5: 135,249,606 D475G probably benign Het
Gdf2 G A 14: 33,941,494 probably null Het
Gpatch1 T C 7: 35,309,351 N82D probably benign Het
Heg1 T A 16: 33,763,591 L1256Q probably damaging Het
Ireb2 T A 9: 54,896,601 probably null Het
Kansl1 T G 11: 104,356,814 H570P probably benign Het
Kcna10 T G 3: 107,194,428 M125R probably damaging Het
Lrp1b T G 2: 40,851,793 I3041L possibly damaging Het
Mbtd1 T C 11: 93,924,648 F354S possibly damaging Het
Mov10 T C 3: 104,802,578 T331A probably benign Het
Ms4a8a A T 19: 11,068,416 S243T probably damaging Het
Ndufa11 T C 17: 56,717,867 S10P probably benign Het
Olfml3 A G 3: 103,736,421 Y215H possibly damaging Het
Olfr315 T A 11: 58,778,879 F251I possibly damaging Het
Olfr663 A G 7: 104,704,322 I252V possibly damaging Het
Pclo T C 5: 14,713,560 S4016P probably benign Het
Pcyox1 G C 6: 86,391,744 A264G probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Pnisr A G 4: 21,874,587 probably benign Het
Prc1 T C 7: 80,313,179 S574P probably damaging Het
Ranbp3l T A 15: 9,007,312 V16D probably damaging Het
Rfx1 T C 8: 84,074,058 V96A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfmbt1 T C 14: 30,815,254 probably null Het
Siglecf T C 7: 43,351,940 Y111H probably damaging Het
Snx14 G A 9: 88,398,294 T536I possibly damaging Het
Spindoc A G 19: 7,374,147 V204A probably benign Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Swt1 G A 1: 151,402,976 Q227* probably null Het
Tg A G 15: 66,759,567 I562V possibly damaging Het
Trip11 T A 12: 101,884,920 I677F probably damaging Het
Vmn1r49 G A 6: 90,072,771 T83I probably benign Het
Vmn1r90 T C 7: 14,561,676 K166E possibly damaging Het
Vmn2r124 T C 17: 18,049,557 I25T possibly damaging Het
Vps13d A T 4: 145,181,207 probably null Het
Zfp106 T C 2: 120,523,968 I170V probably benign Het
Other mutations in Gabbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Gabbr1 APN 17 37048443 nonsense probably null
IGL01309:Gabbr1 APN 17 37048607 critical splice donor site probably null
IGL01413:Gabbr1 APN 17 37062706 missense possibly damaging 0.93
IGL01568:Gabbr1 APN 17 37070669 missense probably damaging 1.00
IGL01845:Gabbr1 APN 17 37048414 splice site probably benign
IGL02083:Gabbr1 APN 17 37070065 missense possibly damaging 0.84
IGL02302:Gabbr1 APN 17 37054797 missense probably damaging 1.00
IGL02430:Gabbr1 APN 17 37056308 nonsense probably null
IGL02533:Gabbr1 APN 17 37072147 missense probably damaging 1.00
IGL02810:Gabbr1 APN 17 37062762 missense probably damaging 1.00
H8562:Gabbr1 UTSW 17 37071949 missense probably damaging 1.00
PIT4449001:Gabbr1 UTSW 17 37056350 missense probably damaging 1.00
R0025:Gabbr1 UTSW 17 37067210 intron probably benign
R0420:Gabbr1 UTSW 17 37046762 missense possibly damaging 0.68
R0464:Gabbr1 UTSW 17 37050834 unclassified probably benign
R1306:Gabbr1 UTSW 17 37055990 intron probably null
R1412:Gabbr1 UTSW 17 37054913 splice site probably null
R1495:Gabbr1 UTSW 17 37055940 missense possibly damaging 0.68
R1612:Gabbr1 UTSW 17 37070669 missense probably damaging 1.00
R1658:Gabbr1 UTSW 17 37047507 missense probably damaging 0.96
R1763:Gabbr1 UTSW 17 37054767 missense probably damaging 1.00
R1779:Gabbr1 UTSW 17 37054879 missense probably damaging 1.00
R1964:Gabbr1 UTSW 17 37048459 missense probably damaging 1.00
R1996:Gabbr1 UTSW 17 37069220 missense probably damaging 1.00
R2014:Gabbr1 UTSW 17 37056782 splice site probably null
R2255:Gabbr1 UTSW 17 37071866 missense probably damaging 1.00
R4299:Gabbr1 UTSW 17 37055900 nonsense probably null
R4458:Gabbr1 UTSW 17 37067775 critical splice acceptor site probably null
R4510:Gabbr1 UTSW 17 37069211 missense probably damaging 1.00
R4511:Gabbr1 UTSW 17 37069211 missense probably damaging 1.00
R4571:Gabbr1 UTSW 17 37054236 nonsense probably null
R4597:Gabbr1 UTSW 17 37056899 missense possibly damaging 0.74
R5109:Gabbr1 UTSW 17 37072028 intron probably benign
R5119:Gabbr1 UTSW 17 37048438 missense probably damaging 0.99
R5253:Gabbr1 UTSW 17 37055913 missense possibly damaging 0.87
R5443:Gabbr1 UTSW 17 37070756 missense probably damaging 1.00
R5485:Gabbr1 UTSW 17 37056875 missense possibly damaging 0.83
R5839:Gabbr1 UTSW 17 37067868 missense probably damaging 1.00
R5976:Gabbr1 UTSW 17 37067862 missense probably damaging 1.00
R6156:Gabbr1 UTSW 17 37048427 missense probably benign 0.01
R6167:Gabbr1 UTSW 17 37063379 missense probably damaging 1.00
R6214:Gabbr1 UTSW 17 37069365 missense probably damaging 1.00
R6215:Gabbr1 UTSW 17 37069365 missense probably damaging 1.00
R6348:Gabbr1 UTSW 17 37056899 missense possibly damaging 0.94
R6721:Gabbr1 UTSW 17 37054192 missense probably damaging 0.98
R7028:Gabbr1 UTSW 17 37064737 nonsense probably null
R7317:Gabbr1 UTSW 17 37069413 missense probably damaging 1.00
R7786:Gabbr1 UTSW 17 37070063 missense probably damaging 0.98
R7793:Gabbr1 UTSW 17 37047501 missense probably benign 0.13
R7833:Gabbr1 UTSW 17 37056969 missense possibly damaging 0.88
R7916:Gabbr1 UTSW 17 37056969 missense possibly damaging 0.88
X0010:Gabbr1 UTSW 17 37070780 missense probably damaging 0.99
Z1177:Gabbr1 UTSW 17 37048424 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- GCACAGTACTGAGTCTCATAGGG -3'
(R):5'- GACACAGATGGGTGAGTCAC -3'

Sequencing Primer
(F):5'- CAGTACTGAGTCTCATAGGGAAGAC -3'
(R):5'- GGCCCTCTGCTGAACATCAC -3'
Posted On2016-07-22