Mutagenetix > Incidental Mutation

Incidental Mutation 'R0415:Lyst'

40271

Institutional Source

Beutler Lab

Gene Symbol

Lyst

Ensembl Gene

ENSMUSG00000019726

Gene Name

lysosomal trafficking regulator

Synonyms

D13Sfk13

MMRRC Submission

038617-MU

Accession Numbers

Ncbi RefSeq: NM_010748.2; MGI:107448

Essential gene?

Possibly non essential (E-score: 0.347) question?

Stock #

R0415 (G1)

Quality Score

220

Status

Validated

Chromosome

Chromosomal Location

13590397-13778803 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 13711610 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000106188 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110559]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000110559

SMART Domains

Protein: ENSMUSP00000106188
Gene: ENSMUSG00000019726

Domain	Start	End	E-Value	Type
low complexity region	26	36	N/A	INTRINSIC
low complexity region	72	82	N/A	INTRINSIC
low complexity region	399	412	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	2295	2307	N/A	INTRINSIC
low complexity region	2427	2445	N/A	INTRINSIC
low complexity region	2534	2546	N/A	INTRINSIC
Pfam:PH_BEACH	3006	3101	5.8e-25	PFAM
Beach	3118	3408	1.25e-193	SMART
Blast:Beach	3441	3478	9e-13	BLAST
WD40	3539	3579	5.75e-1	SMART
WD40	3591	3630	2.89e-5	SMART
WD40	3633	3676	1.38e0	SMART
WD40	3724	3765	1.27e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221717

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.6%

Validation Efficiency

97% (99/102)

MGI Phenotype

Strain: 1855968
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that regulates intracellular protein trafficking in endosomes, and may be involved in pigmentation. Mutations in this gene are associated with Chediak-Higashi syndrome, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants, though the full-length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mice have a phenotype similar to human Chediak-Higashi syndrome patients, exhibiting lysosomal dysfunction with resultant protein storage; diluted coat color; abnormal melanogenesis; immune cell dysfunction resulting in increased susceptibility to bacterial, viral, and parasitic infections and decreased cytotoxic activity against tumor cells. [provided by MGI curators]

Allele List at MGI

All alleles(52) : Targeted(3) Gene trapped(34) Spontaneous(8) Chemically induced(6) Radiation induced(1)

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427G23Rik	A	T	5: 23,831,050		noncoding transcript	Het
Acox2	A	G	14: 8,243,835		probably benign	Het
Adgb	T	C	10: 10,431,067		probably null	Het
Adgra3	C	A	5: 49,961,757		probably benign	Het
Adgre4	G	A	17: 55,852,288	V658I	probably benign	Het
Ahnak	A	G	19: 9,012,871		probably benign	Het
Anapc2	A	G	2: 25,278,325	T159A	probably damaging	Het
Arfgef3	A	G	10: 18,613,127		probably benign	Het
Atf7ip	C	T	6: 136,560,012	S81L	possibly damaging	Het
Cacna1i	A	G	15: 80,368,830		probably benign	Het
Camk1	A	T	6: 113,341,891	Y20*	probably null	Het
Ccdc40	T	C	11: 119,232,118	Y249H	possibly damaging	Het
Cd109	T	A	9: 78,712,615	S1380T	probably benign	Het
Cfap57	A	T	4: 118,569,431	L1107Q	possibly damaging	Het
Col6a4	C	T	9: 106,075,080	V540I	probably damaging	Het
Cst9	T	A	2: 148,838,442		probably benign	Het
Cul5	C	T	9: 53,667,070	V73I	probably benign	Het
Cxcl16	T	A	11: 70,458,748	K84*	probably null	Het
Cyp2c29	T	C	19: 39,329,095		probably benign	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Dip2c	C	T	13: 9,568,289		probably benign	Het
Dis3	A	T	14: 99,087,456	I513N	probably damaging	Het
Dnajc16	A	T	4: 141,789,048	L3*	probably null	Het
Dopey1	T	A	9: 86,506,502	L480M	probably damaging	Het
Eml6	A	G	11: 29,749,392	V1787A	possibly damaging	Het
Etnk1	A	G	6: 143,180,774	N115S	probably damaging	Het
Fryl	T	C	5: 73,098,414	Y758C	probably damaging	Het
Gbp4	G	A	5: 105,121,106	R394C	possibly damaging	Het
Ggnbp2	A	C	11: 84,833,225		probably benign	Het
Gm7137	A	G	10: 77,788,173		probably benign	Het
Gstm2	T	A	3: 107,984,006	Q132L	probably benign	Het
Habp2	T	C	19: 56,317,717		probably benign	Het
Hectd2	T	C	19: 36,584,884		probably benign	Het
Htr6	A	G	4: 139,062,081	I291T	possibly damaging	Het
Ighg2c	T	C	12: 113,287,910	D199G	unknown	Het
Itih2	A	G	2: 10,105,615		probably benign	Het
Kcnab2	A	G	4: 152,395,136	F248S	probably benign	Het
Kcnc4	T	C	3: 107,445,433	K610E	probably damaging	Het
Kcnk16	T	A	14: 20,262,975		probably null	Het
Kndc1	C	T	7: 139,930,124	T1293I	probably damaging	Het
Lcp1	A	T	14: 75,227,006	I556F	possibly damaging	Het
Lrrc8d	T	C	5: 105,811,865	L47P	probably damaging	Het
Macrod2	G	A	2: 142,210,145		probably null	Het
Micalcl	C	T	7: 112,381,028	R70C	probably damaging	Het
Mllt3	ACTGCTGCTGCTGCTGCTGCT	ACTGCTGCTGCTGCTGCT	4: 87,841,339		probably benign	Het
Msh3	A	G	13: 92,346,786	V283A	possibly damaging	Het
Nup205	T	C	6: 35,214,634		probably benign	Het
Nxpe2	T	C	9: 48,326,614	T114A	probably damaging	Het
Olfr1023	A	T	2: 85,887,438	I213F	possibly damaging	Het
Olfr1034	A	T	2: 86,047,055	H191L	probably benign	Het
Olfr229	A	G	9: 39,909,983	Y60C	probably damaging	Het
Olfr78	C	T	7: 102,742,087	M305I	probably benign	Het
Olfr893	A	T	9: 38,209,973	M305L	probably benign	Het
Pard3	G	A	8: 127,610,566	G1221D	probably damaging	Het
Pax5	G	A	4: 44,691,886	A120V	probably damaging	Het
Pcsk6	C	T	7: 66,033,874	R746C	probably damaging	Het
Pif1	G	A	9: 65,588,051	C81Y	probably benign	Het
Plcb1	A	G	2: 135,337,499	Y609C	probably damaging	Het
Plcd4	C	A	1: 74,552,097	S217Y	probably damaging	Het
Plxna1	G	A	6: 89,357,336	H104Y	probably benign	Het
Polr2k	A	G	15: 36,175,456	Y45C	probably damaging	Het
Pqlc3	C	A	12: 16,997,710		probably benign	Het
Prex1	A	G	2: 166,586,699		probably benign	Het
Pth2r	A	G	1: 65,388,439	M424V	probably benign	Het
Pygm	A	G	19: 6,391,366	R464G	probably benign	Het
Rad51c	A	G	11: 87,397,655	L234P	probably damaging	Het
Rnf145	A	G	11: 44,525,138	Y60C	probably damaging	Het
Rnf167	T	C	11: 70,649,699	I135T	probably damaging	Het
Rnf213	A	T	11: 119,414,469	I509F	probably damaging	Het
Ryr2	T	C	13: 11,869,156	S213G	probably damaging	Het
Selenbp1	T	C	3: 94,936,913	V27A	possibly damaging	Het
Selenof	T	G	3: 144,577,692	L14R	probably damaging	Het
Sfswap	A	T	5: 129,504,126	D121V	probably damaging	Het
Slc25a34	C	A	4: 141,620,469	M300I	possibly damaging	Het
Slc34a3	T	G	2: 25,229,110	T583P	probably benign	Het
Smg1	C	A	7: 118,182,468	A1199S	probably benign	Het
Spint1	A	G	2: 119,245,615	T231A	probably damaging	Het
Sptbn1	A	C	11: 30,149,576	N229K	probably damaging	Het
Sult2b1	A	G	7: 45,730,092		probably benign	Het
Tas2r123	A	T	6: 132,847,838	M233L	probably damaging	Het
Tbcel	C	A	9: 42,444,500	C139F	probably benign	Het
Thbs2	A	C	17: 14,679,973	S573A	probably benign	Het
Tmem132c	A	G	5: 127,563,705	E980G	probably damaging	Het
Tmem247	G	T	17: 86,922,322	C197F	probably damaging	Het
Tmem251	T	A	12: 102,744,876	Y119*	probably null	Het
Tmem43	C	A	6: 91,482,318	P257Q	probably benign	Het
Tmprss13	A	G	9: 45,337,132		probably null	Het
Trove2	G	T	1: 143,760,075	N444K	probably benign	Het
Ubr5	T	C	15: 37,972,980	T2626A	probably damaging	Het
Vmn1r196	T	A	13: 22,293,836	V215D	probably damaging	Het
Vmn1r22	G	T	6: 57,900,332	T220K	probably benign	Het
Vmn2r116	G	A	17: 23,387,279	M388I	possibly damaging	Het
Vmn2r74	A	C	7: 85,961,410	C25G	probably damaging	Het
Xndc1	T	C	7: 102,080,616		probably benign	Het
Zfp282	A	G	6: 47,897,881	D340G	probably damaging	Het
Zfp282	T	A	6: 47,905,053	I558N	possibly damaging	Het
Zfp316	T	A	5: 143,264,491	T56S	unknown	Het
Zfp345	A	G	2: 150,474,559		probably benign	Het

Other mutations in Lyst

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Lyst	APN	13	13648878	missense	probably benign
IGL00474:Lyst	APN	13	13643536	missense	possibly damaging	0.48
IGL00484:Lyst	APN	13	13709603	missense	probably benign	0.02
IGL00492:Lyst	APN	13	13678175	missense	possibly damaging	0.54
IGL00807:Lyst	APN	13	13650423	missense	possibly damaging	0.91
IGL00949:Lyst	APN	13	13635485	missense	possibly damaging	0.87
IGL00952:Lyst	APN	13	13678107	missense	probably benign	0.05
IGL01305:Lyst	APN	13	13678056	missense	probably benign	0.01
IGL01317:Lyst	APN	13	13670870	missense	probably benign
IGL01419:Lyst	APN	13	13635838	missense	probably benign	0.00
IGL01445:Lyst	APN	13	13651714	missense	probably benign	0.00
IGL01690:Lyst	APN	13	13743246	missense	probably damaging	1.00
IGL01791:Lyst	APN	13	13635302	missense	probably damaging	1.00
IGL01809:Lyst	APN	13	13637803	missense	probably damaging	1.00
IGL01896:Lyst	APN	13	13635577	missense	probably benign	0.04
IGL01938:Lyst	APN	13	13637424	missense	possibly damaging	0.93
IGL01986:Lyst	APN	13	13775627	critical splice donor site	probably null
IGL02022:Lyst	APN	13	13664044	nonsense	probably null
IGL02044:Lyst	APN	13	13712846	missense	probably damaging	1.00
IGL02157:Lyst	APN	13	13660956	missense	probably benign
IGL02185:Lyst	APN	13	13661093	nonsense	probably null
IGL02215:Lyst	APN	13	13660956	missense	probably benign
IGL02245:Lyst	APN	13	13660956	missense	probably benign
IGL02246:Lyst	APN	13	13660956	missense	probably benign
IGL02247:Lyst	APN	13	13660956	missense	probably benign
IGL02297:Lyst	APN	13	13638092	nonsense	probably null
IGL02411:Lyst	APN	13	13660956	missense	probably benign
IGL02415:Lyst	APN	13	13660956	missense	probably benign
IGL02419:Lyst	APN	13	13660956	missense	probably benign
IGL02420:Lyst	APN	13	13660956	missense	probably benign
IGL02429:Lyst	APN	13	13660956	missense	probably benign
IGL02501:Lyst	APN	13	13711645	missense	probably benign	0.02
IGL02522:Lyst	APN	13	13634705	missense	possibly damaging	0.81
IGL02535:Lyst	APN	13	13650342	missense	probably benign	0.00
IGL02596:Lyst	APN	13	13660956	missense	probably benign
IGL02601:Lyst	APN	13	13660956	missense	probably benign
IGL02603:Lyst	APN	13	13660956	missense	probably benign
IGL02608:Lyst	APN	13	13712754	missense	probably damaging	0.98
IGL02622:Lyst	APN	13	13681390	missense	probably damaging	1.00
IGL02690:Lyst	APN	13	13641125	missense	possibly damaging	0.58
IGL02715:Lyst	APN	13	13674320	splice site	probably null
IGL02725:Lyst	APN	13	13760827	missense	probably damaging	1.00
IGL02729:Lyst	APN	13	13674339	missense	possibly damaging	0.81
IGL02729:Lyst	APN	13	13746609	missense	possibly damaging	0.95
IGL02820:Lyst	APN	13	13638058	missense	probably benign	0.03
IGL02945:Lyst	APN	13	13761198	missense	possibly damaging	0.48
IGL02981:Lyst	APN	13	13634911	missense	probably damaging	0.99
IGL03087:Lyst	APN	13	13635056	missense	probably damaging	1.00
IGL03149:Lyst	APN	13	13681444	missense	probably benign	0.14
IGL03158:Lyst	APN	13	13651752	critical splice donor site	probably null
IGL03226:Lyst	APN	13	13709559	missense	probably benign	0.01
IGL03242:Lyst	APN	13	13656881	nonsense	probably null
IGL03385:Lyst	APN	13	13656980	nonsense	probably null
50-cal	UTSW	13	13708212	critical splice donor site	probably null
charcoal	UTSW	13	13696761	nonsense	probably null
charlotte_gray	UTSW	13	13602026	intron	probably benign
charzard	UTSW	13	13647083	nonsense	probably null
grey_wolf	UTSW	13		unclassified
lightspeed	UTSW	13	13740536	missense	possibly damaging	0.91
pardon	UTSW	13	13677952	missense	probably benign	0.00
robin	UTSW	13	13648802	nonsense	probably null
sooty	UTSW	13		unclassified
souris	UTSW	13	13683223	unclassified	probably benign
Swallow	UTSW	13	13757422	missense	probably benign	0.00
vulpix	UTSW	13	13696794	splice site	probably null
ANU22:Lyst	UTSW	13	13678056	missense	probably benign	0.01
IGL02835:Lyst	UTSW	13	13661100	missense	possibly damaging	0.82
P0031:Lyst	UTSW	13	13664031	missense	probably damaging	1.00
R0012:Lyst	UTSW	13	13687694	missense	probably benign	0.10
R0012:Lyst	UTSW	13	13687694	missense	probably benign	0.10
R0031:Lyst	UTSW	13	13708156	missense	probably benign	0.14
R0115:Lyst	UTSW	13	13677952	missense	probably benign	0.00
R0212:Lyst	UTSW	13	13635985	missense	possibly damaging	0.93
R0386:Lyst	UTSW	13	13708214	splice site	probably benign
R0393:Lyst	UTSW	13	13647079	missense	probably benign	0.01
R0446:Lyst	UTSW	13	13638048	missense	probably benign	0.00
R0481:Lyst	UTSW	13	13677952	missense	probably benign	0.00
R0499:Lyst	UTSW	13	13616713	missense	probably damaging	1.00
R0506:Lyst	UTSW	13	13638015	missense	probably benign
R0530:Lyst	UTSW	13	13757306	splice site	probably benign
R0541:Lyst	UTSW	13	13681293	missense	probably benign	0.00
R0570:Lyst	UTSW	13	13709386	missense	probably benign	0.26
R0680:Lyst	UTSW	13	13650341	missense	probably benign	0.01
R0842:Lyst	UTSW	13	13678241	nonsense	probably null
R0848:Lyst	UTSW	13	13634930	missense	probably benign	0.00
R1014:Lyst	UTSW	13	13634060	missense	possibly damaging	0.49
R1205:Lyst	UTSW	13	13680202	missense	probably benign
R1251:Lyst	UTSW	13	13634483	missense	probably benign	0.00
R1304:Lyst	UTSW	13	13751984	nonsense	probably null
R1398:Lyst	UTSW	13	13740536	missense	possibly damaging	0.91
R1445:Lyst	UTSW	13	13640054	missense	possibly damaging	0.94
R1475:Lyst	UTSW	13	13708212	critical splice donor site	probably null
R1479:Lyst	UTSW	13	13634482	missense	probably benign	0.00
R1484:Lyst	UTSW	13	13678190	missense	probably benign	0.01
R1498:Lyst	UTSW	13	13650375	missense	possibly damaging	0.49
R1540:Lyst	UTSW	13	13635101	missense	possibly damaging	0.81
R1611:Lyst	UTSW	13	13634897	missense	probably damaging	0.97
R1653:Lyst	UTSW	13	13635226	missense	probably damaging	1.00
R1669:Lyst	UTSW	13	13644087	missense	possibly damaging	0.90
R1686:Lyst	UTSW	13	13634705	missense	possibly damaging	0.81
R1694:Lyst	UTSW	13	13661161	missense	probably damaging	0.98
R1747:Lyst	UTSW	13	13757422	missense	probably benign	0.00
R1793:Lyst	UTSW	13	13647083	nonsense	probably null
R1871:Lyst	UTSW	13	13651712	missense	probably benign	0.00
R1905:Lyst	UTSW	13	13634134	missense	probably benign
R1958:Lyst	UTSW	13	13616618	missense	probably damaging	1.00
R1969:Lyst	UTSW	13	13730344	missense	probably damaging	0.99
R2040:Lyst	UTSW	13	13641222	missense	probably benign	0.00
R2109:Lyst	UTSW	13	13712820	missense	possibly damaging	0.46
R2116:Lyst	UTSW	13	13635701	missense	probably damaging	0.99
R2121:Lyst	UTSW	13	13660971	missense	probably damaging	1.00
R2127:Lyst	UTSW	13	13635262	missense	probably damaging	1.00
R2187:Lyst	UTSW	13	13709341	missense	possibly damaging	0.61
R2238:Lyst	UTSW	13	13743263	missense	probably benign	0.41
R2258:Lyst	UTSW	13	13637658	missense	probably benign	0.00
R2292:Lyst	UTSW	13	13740495	missense	probably damaging	1.00
R2368:Lyst	UTSW	13	13696663	missense	probably damaging	0.96
R2908:Lyst	UTSW	13	13669873	missense	probably benign	0.03
R3001:Lyst	UTSW	13	13696705	missense	probably benign
R3002:Lyst	UTSW	13	13696705	missense	probably benign
R3024:Lyst	UTSW	13	13658687	missense	probably benign
R3113:Lyst	UTSW	13	13669927	missense	probably benign	0.12
R3406:Lyst	UTSW	13	13635230	missense	possibly damaging	0.56
R3972:Lyst	UTSW	13	13706625	missense	possibly damaging	0.67
R3978:Lyst	UTSW	13	13634168	missense	possibly damaging	0.82
R4032:Lyst	UTSW	13	13616665	missense	probably damaging	1.00
R4192:Lyst	UTSW	13	13740513	missense	probably damaging	1.00
R4206:Lyst	UTSW	13	13635989	missense	probably benign	0.03
R4298:Lyst	UTSW	13	13634887	missense	probably damaging	1.00
R4344:Lyst	UTSW	13	13698466	missense	probably benign	0.06
R4441:Lyst	UTSW	13	13635383	missense	probably damaging	1.00
R4445:Lyst	UTSW	13	13709564	missense	probably benign	0.42
R4477:Lyst	UTSW	13	13635383	missense	probably damaging	1.00
R4493:Lyst	UTSW	13	13635383	missense	probably damaging	1.00
R4494:Lyst	UTSW	13	13635383	missense	probably damaging	1.00
R4495:Lyst	UTSW	13	13635383	missense	probably damaging	1.00
R4622:Lyst	UTSW	13	13674398	missense	probably benign	0.01
R4638:Lyst	UTSW	13	13696794	splice site	probably null
R4658:Lyst	UTSW	13	13635383	missense	probably damaging	1.00
R4675:Lyst	UTSW	13	13635383	missense	probably damaging	1.00
R4719:Lyst	UTSW	13	13650350	missense	probably benign
R4729:Lyst	UTSW	13	13637901	missense	probably damaging	1.00
R4774:Lyst	UTSW	13	13740597	missense	probably damaging	1.00
R4811:Lyst	UTSW	13	13777100	missense	probably benign	0.33
R4877:Lyst	UTSW	13	13683149	missense	probably damaging	1.00
R4920:Lyst	UTSW	13	13647060	missense	possibly damaging	0.79
R4933:Lyst	UTSW	13	13637764	missense	probably damaging	0.98
R4933:Lyst	UTSW	13	13759378	missense	probably benign	0.12
R4958:Lyst	UTSW	13	13635463	missense	probably benign	0.00
R4982:Lyst	UTSW	13	13725954	missense	probably damaging	1.00
R4992:Lyst	UTSW	13	13661163	missense	probably damaging	1.00
R5024:Lyst	UTSW	13	13634404	missense	probably benign
R5049:Lyst	UTSW	13	13636064	missense	probably damaging	1.00
R5079:Lyst	UTSW	13	13757353	missense	probably benign	0.08
R5254:Lyst	UTSW	13	13683070	missense	probably benign	0.00
R5266:Lyst	UTSW	13	13660970	missense	probably damaging	1.00
R5279:Lyst	UTSW	13	13648802	nonsense	probably null
R5285:Lyst	UTSW	13	13634426	missense	probably benign	0.01
R5364:Lyst	UTSW	13	13656854	missense	probably benign	0.35
R5435:Lyst	UTSW	13	13777064	missense	possibly damaging	0.64
R5516:Lyst	UTSW	13	13644122	missense	probably benign	0.10
R5524:Lyst	UTSW	13	13746779	missense	probably benign	0.03
R5591:Lyst	UTSW	13	13743333	missense	probably damaging	0.99
R5592:Lyst	UTSW	13	13743333	missense	probably damaging	0.99
R5593:Lyst	UTSW	13	13743333	missense	probably damaging	0.99
R5594:Lyst	UTSW	13	13743333	missense	probably damaging	0.99
R5594:Lyst	UTSW	13	13759397	missense	probably benign	0.00
R5644:Lyst	UTSW	13	13637496	missense	possibly damaging	0.58
R5659:Lyst	UTSW	13	13634627	missense	possibly damaging	0.58
R5741:Lyst	UTSW	13	13634030	missense	probably benign	0.44
R5908:Lyst	UTSW	13	13696761	nonsense	probably null
R5969:Lyst	UTSW	13	13687813	splice site	probably null
R6128:Lyst	UTSW	13	13759379	missense	possibly damaging	0.67
R6271:Lyst	UTSW	13	13658754	missense	probably benign	0.30
R6315:Lyst	UTSW	13	13643504	missense	probably benign
R6318:Lyst	UTSW	13	13743311	missense	possibly damaging	0.88
R6555:Lyst	UTSW	13	13648925	missense	probably benign	0.01
R6663:Lyst	UTSW	13	13664116	splice site	probably null
R6701:Lyst	UTSW	13	13681485	missense	probably benign	0.06
R6711:Lyst	UTSW	13	13635235	missense	possibly damaging	0.80
R6909:Lyst	UTSW	13	13743375	missense	probably damaging	1.00
R6915:Lyst	UTSW	13	13726044	missense	probably benign	0.01
R6929:Lyst	UTSW	13	13743324	missense	probably damaging	1.00
R6960:Lyst	UTSW	13	13634078	missense	probably benign	0.12
R7018:Lyst	UTSW	13	13743459	critical splice donor site	probably null
R7037:Lyst	UTSW	13	13616666	missense	probably damaging	1.00
R7045:Lyst	UTSW	13	13634900	missense	probably benign	0.34
R7045:Lyst	UTSW	13	13637708	missense	probably damaging	1.00
R7070:Lyst	UTSW	13	13757444	missense	probably benign	0.23
R7188:Lyst	UTSW	13	13752090	missense	possibly damaging	0.66
R7201:Lyst	UTSW	13	13709300	nonsense	probably null
R7210:Lyst	UTSW	13	13656983	missense	probably damaging	1.00
R7229:Lyst	UTSW	13	13643509	missense	probably benign	0.00
R7293:Lyst	UTSW	13	13680237	missense	probably benign	0.01
R7318:Lyst	UTSW	13	13757443	missense	probably benign	0.13
R7344:Lyst	UTSW	13	13706555	missense	probably benign
R7426:Lyst	UTSW	13	13637524	missense	probably benign
R7522:Lyst	UTSW	13	13647083	nonsense	probably null
R7583:Lyst	UTSW	13	13635887	missense	probably damaging	1.00
R7606:Lyst	UTSW	13	13637475	missense	probably damaging	1.00
R7636:Lyst	UTSW	13	13616747	critical splice donor site	probably null
R7658:Lyst	UTSW	13	13730476	missense	possibly damaging	0.63
R7685:Lyst	UTSW	13	13669865	missense	probably benign	0.00
R7689:Lyst	UTSW	13	13683223	critical splice donor site	probably null
R7765:Lyst	UTSW	13	13709532	missense	possibly damaging	0.75
R7779:Lyst	UTSW	13	13634543	missense	probably damaging	1.00
R7871:Lyst	UTSW	13	13636052	nonsense	probably null
R7872:Lyst	UTSW	13	13635865	missense	probably benign	0.14
R7884:Lyst	UTSW	13	13707683	missense	probably benign	0.09
R7890:Lyst	UTSW	13	13740569	missense	probably damaging	0.99
R7916:Lyst	UTSW	13	13647072	missense	possibly damaging	0.64
R7948:Lyst	UTSW	13	13746589	missense	possibly damaging	0.59
R7956:Lyst	UTSW	13	13641203	missense	possibly damaging	0.80
R8048:Lyst	UTSW	13	13687645	missense	probably benign	0.12
R8085:Lyst	UTSW	13	13634309	missense	probably damaging	0.98
R8165:Lyst	UTSW	13	13698360	missense	probably damaging	0.99
R8235:Lyst	UTSW	13	13760738	missense	possibly damaging	0.69
R8237:Lyst	UTSW	13	13651732	missense	probably benign	0.00
R8275:Lyst	UTSW	13	13776082	missense	probably benign	0.02
R8300:Lyst	UTSW	13	13664058	missense	possibly damaging	0.79
R8350:Lyst	UTSW	13	13650388	nonsense	probably null
R8526:Lyst	UTSW	13	13760806	missense	probably damaging	0.99
R8551:Lyst	UTSW	13	13634060	missense	possibly damaging	0.77
R8723:Lyst	UTSW	13	13712757	missense	possibly damaging	0.89
R8772:Lyst	UTSW	13	13637492	nonsense	probably null
R8778:Lyst	UTSW	13	13635776	missense	possibly damaging	0.89
R8778:Lyst	UTSW	13	13728567	missense	possibly damaging	0.89
R8801:Lyst	UTSW	13	13661010	missense	probably benign	0.10
R8837:Lyst	UTSW	13	13677963	missense	probably benign
R8874:Lyst	UTSW	13	13637562	missense	probably benign
R8878:Lyst	UTSW	13	13641076	missense	probably benign	0.00
R8891:Lyst	UTSW	13	13712850	missense	possibly damaging	0.67
R9077:Lyst	UTSW	13	13683108	missense	probably benign	0.02
R9127:Lyst	UTSW	13	13634242	missense	probably damaging	1.00
R9143:Lyst	UTSW	13	13661165	missense	probably damaging	0.98
R9216:Lyst	UTSW	13	13648603	missense	probably benign
R9217:Lyst	UTSW	13	13696660	missense	probably benign	0.01
R9291:Lyst	UTSW	13	13709353	missense	probably benign	0.01
R9302:Lyst	UTSW	13	13730362	missense	possibly damaging	0.46
R9370:Lyst	UTSW	13	13760748	missense	probably damaging	1.00
R9402:Lyst	UTSW	13	13637878	missense	probably benign
R9457:Lyst	UTSW	13	13687745	missense	possibly damaging	0.83
R9481:Lyst	UTSW	13	13683068	missense	possibly damaging	0.68
R9563:Lyst	UTSW	13	13637823	missense	probably benign	0.36
R9623:Lyst	UTSW	13	13678002	missense	probably benign
R9661:Lyst	UTSW	13	13634194	missense	probably benign	0.01
R9682:Lyst	UTSW	13	13656941	missense	probably benign	0.21
R9743:Lyst	UTSW	13	13634738	missense	possibly damaging	0.67
R9801:Lyst	UTSW	13	13634705	missense	probably damaging	0.97
RF001:Lyst	UTSW	13	13635841	missense	probably benign
RF002:Lyst	UTSW	13	13634363	missense	probably benign	0.05
X0024:Lyst	UTSW	13	13634448	missense	probably benign	0.00
X0026:Lyst	UTSW	13	13751970	missense	probably damaging	0.99
Z1088:Lyst	UTSW	13	13743433	missense	probably benign	0.09
Z1176:Lyst	UTSW	13	13640107	missense	probably damaging	1.00
Z1176:Lyst	UTSW	13	13777079	missense	probably benign	0.27
Z1177:Lyst	UTSW	13	13680134	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- TAGACTTGGAGACACGACCCAAGG -3'
(R):5'- TAGTCCACACAGTGGTAGGTGAGC -3'

Sequencing Primer
(F):5'- CCCTTTTTAGCAATAAGACAAAGGC -3'
(R):5'- AGCTCTGTCTACATTGGATTTACG -3'

Posted On

2013-05-23