Incidental Mutation 'R0415:Lyst'
ID 40271
Institutional Source Beutler Lab
Gene Symbol Lyst
Ensembl Gene ENSMUSG00000019726
Gene Name lysosomal trafficking regulator
Synonyms D13Sfk13
MMRRC Submission 038617-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.395) question?
Stock # R0415 (G1)
Quality Score 220
Status Validated
Chromosome 13
Chromosomal Location 13764982-13953388 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 13886195 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110559]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000110559
SMART Domains Protein: ENSMUSP00000106188
Gene: ENSMUSG00000019726

DomainStartEndE-ValueType
low complexity region 26 36 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 2295 2307 N/A INTRINSIC
low complexity region 2427 2445 N/A INTRINSIC
low complexity region 2534 2546 N/A INTRINSIC
Pfam:PH_BEACH 3006 3101 5.8e-25 PFAM
Beach 3118 3408 1.25e-193 SMART
Blast:Beach 3441 3478 9e-13 BLAST
WD40 3539 3579 5.75e-1 SMART
WD40 3591 3630 2.89e-5 SMART
WD40 3633 3676 1.38e0 SMART
WD40 3724 3765 1.27e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221717
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (99/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that regulates intracellular protein trafficking in endosomes, and may be involved in pigmentation. Mutations in this gene are associated with Chediak-Higashi syndrome, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants, though the full-length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mice have a phenotype similar to human Chediak-Higashi syndrome patients, exhibiting lysosomal dysfunction with resultant protein storage; diluted coat color; abnormal melanogenesis; immune cell dysfunction resulting in increased susceptibility to bacterial, viral, and parasitic infections and decreased cytotoxic activity against tumor cells. [provided by MGI curators]
Allele List at MGI

All alleles(52) : Targeted(3) Gene trapped(34) Spontaneous(8) Chemically induced(6) Radiation induced(1)

Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427G23Rik A T 5: 24,036,048 (GRCm39) noncoding transcript Het
Acox2 A G 14: 8,243,835 (GRCm38) probably benign Het
Adgb T C 10: 10,306,811 (GRCm39) probably null Het
Adgra3 C A 5: 50,119,099 (GRCm39) probably benign Het
Adgre4 G A 17: 56,159,288 (GRCm39) V658I probably benign Het
Ahnak A G 19: 8,990,235 (GRCm39) probably benign Het
Anapc2 A G 2: 25,168,337 (GRCm39) T159A probably damaging Het
Arfgef3 A G 10: 18,488,875 (GRCm39) probably benign Het
Atf7ip C T 6: 136,537,010 (GRCm39) S81L possibly damaging Het
Cacna1i A G 15: 80,253,031 (GRCm39) probably benign Het
Camk1 A T 6: 113,318,852 (GRCm39) Y20* probably null Het
Ccdc40 T C 11: 119,122,944 (GRCm39) Y249H possibly damaging Het
Cd109 T A 9: 78,619,897 (GRCm39) S1380T probably benign Het
Cfap57 A T 4: 118,426,628 (GRCm39) L1107Q possibly damaging Het
Col6a4 C T 9: 105,952,279 (GRCm39) V540I probably damaging Het
Cst9 T A 2: 148,680,362 (GRCm39) probably benign Het
Cul5 C T 9: 53,578,370 (GRCm39) V73I probably benign Het
Cxcl16 T A 11: 70,349,574 (GRCm39) K84* probably null Het
Cyp2c29 T C 19: 39,317,539 (GRCm39) probably benign Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Het
Dip2c C T 13: 9,618,325 (GRCm39) probably benign Het
Dis3 A T 14: 99,324,892 (GRCm39) I513N probably damaging Het
Dnajc16 A T 4: 141,516,359 (GRCm39) L3* probably null Het
Dop1a T A 9: 86,388,555 (GRCm39) L480M probably damaging Het
Eml6 A G 11: 29,699,392 (GRCm39) V1787A possibly damaging Het
Etnk1 A G 6: 143,126,500 (GRCm39) N115S probably damaging Het
Fryl T C 5: 73,255,757 (GRCm39) Y758C probably damaging Het
Gbp4 G A 5: 105,268,972 (GRCm39) R394C possibly damaging Het
Ggnbp2 A C 11: 84,724,051 (GRCm39) probably benign Het
Gm7137 A G 10: 77,624,007 (GRCm39) probably benign Het
Gstm2 T A 3: 107,891,322 (GRCm39) Q132L probably benign Het
Habp2 T C 19: 56,306,149 (GRCm39) probably benign Het
Hectd2 T C 19: 36,562,284 (GRCm39) probably benign Het
Htr6 A G 4: 138,789,392 (GRCm39) I291T possibly damaging Het
Ighg2c T C 12: 113,251,530 (GRCm39) D199G unknown Het
Itih2 A G 2: 10,110,426 (GRCm39) probably benign Het
Kcnab2 A G 4: 152,479,593 (GRCm39) F248S probably benign Het
Kcnc4 T C 3: 107,352,749 (GRCm39) K610E probably damaging Het
Kcnk16 T A 14: 20,313,043 (GRCm39) probably null Het
Kndc1 C T 7: 139,510,037 (GRCm39) T1293I probably damaging Het
Lcp1 A T 14: 75,464,446 (GRCm39) I556F possibly damaging Het
Lrrc8d T C 5: 105,959,731 (GRCm39) L47P probably damaging Het
Lyset T A 12: 102,711,135 (GRCm39) Y119* probably null Het
Macrod2 G A 2: 142,052,065 (GRCm39) probably null Het
Mical2 C T 7: 111,980,235 (GRCm39) R70C probably damaging Het
Mllt3 ACTGCTGCTGCTGCTGCTGCT ACTGCTGCTGCTGCTGCT 4: 87,759,576 (GRCm39) probably benign Het
Msh3 A G 13: 92,483,294 (GRCm39) V283A possibly damaging Het
Nup205 T C 6: 35,191,569 (GRCm39) probably benign Het
Nxpe2 T C 9: 48,237,914 (GRCm39) T114A probably damaging Het
Or51e2 C T 7: 102,391,294 (GRCm39) M305I probably benign Het
Or5m10 A T 2: 85,717,782 (GRCm39) I213F possibly damaging Het
Or5m9 A T 2: 85,877,399 (GRCm39) H191L probably benign Het
Or8c15 A T 9: 38,121,269 (GRCm39) M305L probably benign Het
Or8g2 A G 9: 39,821,279 (GRCm39) Y60C probably damaging Het
Pard3 G A 8: 128,337,047 (GRCm39) G1221D probably damaging Het
Pax5 G A 4: 44,691,886 (GRCm39) A120V probably damaging Het
Pcsk6 C T 7: 65,683,622 (GRCm39) R746C probably damaging Het
Pif1 G A 9: 65,495,333 (GRCm39) C81Y probably benign Het
Plcb1 A G 2: 135,179,419 (GRCm39) Y609C probably damaging Het
Plcd4 C A 1: 74,591,256 (GRCm39) S217Y probably damaging Het
Plxna1 G A 6: 89,334,318 (GRCm39) H104Y probably benign Het
Polr2k A G 15: 36,175,602 (GRCm39) Y45C probably damaging Het
Prex1 A G 2: 166,428,619 (GRCm39) probably benign Het
Pth2r A G 1: 65,427,598 (GRCm39) M424V probably benign Het
Pygm A G 19: 6,441,396 (GRCm39) R464G probably benign Het
Rad51c A G 11: 87,288,481 (GRCm39) L234P probably damaging Het
Rnf145 A G 11: 44,415,965 (GRCm39) Y60C probably damaging Het
Rnf167 T C 11: 70,540,525 (GRCm39) I135T probably damaging Het
Rnf213 A T 11: 119,305,295 (GRCm39) I509F probably damaging Het
Ro60 G T 1: 143,635,813 (GRCm39) N444K probably benign Het
Ryr2 T C 13: 11,884,042 (GRCm39) S213G probably damaging Het
Selenbp1 T C 3: 94,844,224 (GRCm39) V27A possibly damaging Het
Selenof T G 3: 144,283,453 (GRCm39) L14R probably damaging Het
Sfswap A T 5: 129,581,190 (GRCm39) D121V probably damaging Het
Slc25a34 C A 4: 141,347,780 (GRCm39) M300I possibly damaging Het
Slc34a3 T G 2: 25,119,122 (GRCm39) T583P probably benign Het
Slc66a3 C A 12: 17,047,711 (GRCm39) probably benign Het
Smg1 C A 7: 117,781,691 (GRCm39) A1199S probably benign Het
Spint1 A G 2: 119,076,096 (GRCm39) T231A probably damaging Het
Sptbn1 A C 11: 30,099,576 (GRCm39) N229K probably damaging Het
Sult2b1 A G 7: 45,379,516 (GRCm39) probably benign Het
Tas2r123 A T 6: 132,824,801 (GRCm39) M233L probably damaging Het
Tbcel C A 9: 42,355,796 (GRCm39) C139F probably benign Het
Thbs2 A C 17: 14,900,235 (GRCm39) S573A probably benign Het
Tmem132c A G 5: 127,640,769 (GRCm39) E980G probably damaging Het
Tmem247 G T 17: 87,229,750 (GRCm39) C197F probably damaging Het
Tmem43 C A 6: 91,459,300 (GRCm39) P257Q probably benign Het
Tmprss13 A G 9: 45,248,430 (GRCm39) probably null Het
Ubr5 T C 15: 37,973,224 (GRCm39) T2626A probably damaging Het
Vmn1r196 T A 13: 22,478,006 (GRCm39) V215D probably damaging Het
Vmn1r22 G T 6: 57,877,317 (GRCm39) T220K probably benign Het
Vmn2r116 G A 17: 23,606,253 (GRCm39) M388I possibly damaging Het
Vmn2r74 A C 7: 85,610,618 (GRCm39) C25G probably damaging Het
Xndc1 T C 7: 101,729,823 (GRCm39) probably benign Het
Zfp282 A G 6: 47,874,815 (GRCm39) D340G probably damaging Het
Zfp282 T A 6: 47,881,987 (GRCm39) I558N possibly damaging Het
Zfp316 T A 5: 143,250,246 (GRCm39) T56S unknown Het
Zfp345 A G 2: 150,316,479 (GRCm39) probably benign Het
Other mutations in Lyst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Lyst APN 13 13,823,463 (GRCm39) missense probably benign
IGL00474:Lyst APN 13 13,818,121 (GRCm39) missense possibly damaging 0.48
IGL00484:Lyst APN 13 13,884,188 (GRCm39) missense probably benign 0.02
IGL00492:Lyst APN 13 13,852,760 (GRCm39) missense possibly damaging 0.54
IGL00807:Lyst APN 13 13,825,008 (GRCm39) missense possibly damaging 0.91
IGL00949:Lyst APN 13 13,810,070 (GRCm39) missense possibly damaging 0.87
IGL00952:Lyst APN 13 13,852,692 (GRCm39) missense probably benign 0.05
IGL01305:Lyst APN 13 13,852,641 (GRCm39) missense probably benign 0.01
IGL01317:Lyst APN 13 13,845,455 (GRCm39) missense probably benign
IGL01419:Lyst APN 13 13,810,423 (GRCm39) missense probably benign 0.00
IGL01445:Lyst APN 13 13,826,299 (GRCm39) missense probably benign 0.00
IGL01690:Lyst APN 13 13,917,831 (GRCm39) missense probably damaging 1.00
IGL01791:Lyst APN 13 13,809,887 (GRCm39) missense probably damaging 1.00
IGL01809:Lyst APN 13 13,812,388 (GRCm39) missense probably damaging 1.00
IGL01896:Lyst APN 13 13,810,162 (GRCm39) missense probably benign 0.04
IGL01938:Lyst APN 13 13,812,009 (GRCm39) missense possibly damaging 0.93
IGL01986:Lyst APN 13 13,950,212 (GRCm39) critical splice donor site probably null
IGL02022:Lyst APN 13 13,838,629 (GRCm39) nonsense probably null
IGL02044:Lyst APN 13 13,887,431 (GRCm39) missense probably damaging 1.00
IGL02157:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02185:Lyst APN 13 13,835,678 (GRCm39) nonsense probably null
IGL02215:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02245:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02246:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02247:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02297:Lyst APN 13 13,812,677 (GRCm39) nonsense probably null
IGL02411:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02415:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02419:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02420:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02429:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02501:Lyst APN 13 13,886,230 (GRCm39) missense probably benign 0.02
IGL02522:Lyst APN 13 13,809,290 (GRCm39) missense possibly damaging 0.81
IGL02535:Lyst APN 13 13,824,927 (GRCm39) missense probably benign 0.00
IGL02596:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02601:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02603:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02608:Lyst APN 13 13,887,339 (GRCm39) missense probably damaging 0.98
IGL02622:Lyst APN 13 13,855,975 (GRCm39) missense probably damaging 1.00
IGL02690:Lyst APN 13 13,815,710 (GRCm39) missense possibly damaging 0.58
IGL02715:Lyst APN 13 13,848,905 (GRCm39) splice site probably null
IGL02725:Lyst APN 13 13,935,412 (GRCm39) missense probably damaging 1.00
IGL02729:Lyst APN 13 13,921,194 (GRCm39) missense possibly damaging 0.95
IGL02729:Lyst APN 13 13,848,924 (GRCm39) missense possibly damaging 0.81
IGL02820:Lyst APN 13 13,812,643 (GRCm39) missense probably benign 0.03
IGL02945:Lyst APN 13 13,935,783 (GRCm39) missense possibly damaging 0.48
IGL02981:Lyst APN 13 13,809,496 (GRCm39) missense probably damaging 0.99
IGL03087:Lyst APN 13 13,809,641 (GRCm39) missense probably damaging 1.00
IGL03149:Lyst APN 13 13,856,029 (GRCm39) missense probably benign 0.14
IGL03158:Lyst APN 13 13,826,337 (GRCm39) critical splice donor site probably null
IGL03226:Lyst APN 13 13,884,144 (GRCm39) missense probably benign 0.01
IGL03242:Lyst APN 13 13,831,466 (GRCm39) nonsense probably null
IGL03385:Lyst APN 13 13,831,565 (GRCm39) nonsense probably null
50-cal UTSW 13 13,882,797 (GRCm39) critical splice donor site probably null
charcoal UTSW 13 13,871,346 (GRCm39) nonsense probably null
charlotte_gray UTSW 13 13,602,026 (GRCm38) intron probably benign
charzard UTSW 13 13,821,668 (GRCm39) nonsense probably null
grey_wolf UTSW 13 0 () unclassified
lightspeed UTSW 13 13,915,121 (GRCm39) missense possibly damaging 0.91
pardon UTSW 13 13,852,537 (GRCm39) missense probably benign 0.00
robin UTSW 13 13,823,387 (GRCm39) nonsense probably null
sooty UTSW 13 0 () unclassified
souris UTSW 13 13,857,808 (GRCm39) unclassified probably benign
Swallow UTSW 13 13,932,007 (GRCm39) missense probably benign 0.00
vulpix UTSW 13 13,871,379 (GRCm39) splice site probably null
ANU22:Lyst UTSW 13 13,852,641 (GRCm39) missense probably benign 0.01
IGL02835:Lyst UTSW 13 13,835,685 (GRCm39) missense possibly damaging 0.82
P0031:Lyst UTSW 13 13,838,616 (GRCm39) missense probably damaging 1.00
R0012:Lyst UTSW 13 13,862,279 (GRCm39) missense probably benign 0.10
R0012:Lyst UTSW 13 13,862,279 (GRCm39) missense probably benign 0.10
R0031:Lyst UTSW 13 13,882,741 (GRCm39) missense probably benign 0.14
R0115:Lyst UTSW 13 13,852,537 (GRCm39) missense probably benign 0.00
R0212:Lyst UTSW 13 13,810,570 (GRCm39) missense possibly damaging 0.93
R0386:Lyst UTSW 13 13,882,799 (GRCm39) splice site probably benign
R0393:Lyst UTSW 13 13,821,664 (GRCm39) missense probably benign 0.01
R0446:Lyst UTSW 13 13,812,633 (GRCm39) missense probably benign 0.00
R0481:Lyst UTSW 13 13,852,537 (GRCm39) missense probably benign 0.00
R0499:Lyst UTSW 13 13,791,298 (GRCm39) missense probably damaging 1.00
R0506:Lyst UTSW 13 13,812,600 (GRCm39) missense probably benign
R0530:Lyst UTSW 13 13,931,891 (GRCm39) splice site probably benign
R0541:Lyst UTSW 13 13,855,878 (GRCm39) missense probably benign 0.00
R0570:Lyst UTSW 13 13,883,971 (GRCm39) missense probably benign 0.26
R0680:Lyst UTSW 13 13,824,926 (GRCm39) missense probably benign 0.01
R0842:Lyst UTSW 13 13,852,826 (GRCm39) nonsense probably null
R0848:Lyst UTSW 13 13,809,515 (GRCm39) missense probably benign 0.00
R1014:Lyst UTSW 13 13,808,645 (GRCm39) missense possibly damaging 0.49
R1205:Lyst UTSW 13 13,854,787 (GRCm39) missense probably benign
R1251:Lyst UTSW 13 13,809,068 (GRCm39) missense probably benign 0.00
R1304:Lyst UTSW 13 13,926,569 (GRCm39) nonsense probably null
R1398:Lyst UTSW 13 13,915,121 (GRCm39) missense possibly damaging 0.91
R1445:Lyst UTSW 13 13,814,639 (GRCm39) missense possibly damaging 0.94
R1475:Lyst UTSW 13 13,882,797 (GRCm39) critical splice donor site probably null
R1479:Lyst UTSW 13 13,809,067 (GRCm39) missense probably benign 0.00
R1484:Lyst UTSW 13 13,852,775 (GRCm39) missense probably benign 0.01
R1498:Lyst UTSW 13 13,824,960 (GRCm39) missense possibly damaging 0.49
R1540:Lyst UTSW 13 13,809,686 (GRCm39) missense possibly damaging 0.81
R1611:Lyst UTSW 13 13,809,482 (GRCm39) missense probably damaging 0.97
R1653:Lyst UTSW 13 13,809,811 (GRCm39) missense probably damaging 1.00
R1669:Lyst UTSW 13 13,818,672 (GRCm39) missense possibly damaging 0.90
R1686:Lyst UTSW 13 13,809,290 (GRCm39) missense possibly damaging 0.81
R1694:Lyst UTSW 13 13,835,746 (GRCm39) missense probably damaging 0.98
R1747:Lyst UTSW 13 13,932,007 (GRCm39) missense probably benign 0.00
R1793:Lyst UTSW 13 13,821,668 (GRCm39) nonsense probably null
R1871:Lyst UTSW 13 13,826,297 (GRCm39) missense probably benign 0.00
R1905:Lyst UTSW 13 13,808,719 (GRCm39) missense probably benign
R1958:Lyst UTSW 13 13,791,203 (GRCm39) missense probably damaging 1.00
R1969:Lyst UTSW 13 13,904,929 (GRCm39) missense probably damaging 0.99
R2040:Lyst UTSW 13 13,815,807 (GRCm39) missense probably benign 0.00
R2109:Lyst UTSW 13 13,887,405 (GRCm39) missense possibly damaging 0.46
R2116:Lyst UTSW 13 13,810,286 (GRCm39) missense probably damaging 0.99
R2121:Lyst UTSW 13 13,835,556 (GRCm39) missense probably damaging 1.00
R2127:Lyst UTSW 13 13,809,847 (GRCm39) missense probably damaging 1.00
R2187:Lyst UTSW 13 13,883,926 (GRCm39) missense possibly damaging 0.61
R2238:Lyst UTSW 13 13,917,848 (GRCm39) missense probably benign 0.41
R2258:Lyst UTSW 13 13,812,243 (GRCm39) missense probably benign 0.00
R2292:Lyst UTSW 13 13,915,080 (GRCm39) missense probably damaging 1.00
R2368:Lyst UTSW 13 13,871,248 (GRCm39) missense probably damaging 0.96
R2908:Lyst UTSW 13 13,844,458 (GRCm39) missense probably benign 0.03
R3001:Lyst UTSW 13 13,871,290 (GRCm39) missense probably benign
R3002:Lyst UTSW 13 13,871,290 (GRCm39) missense probably benign
R3024:Lyst UTSW 13 13,833,272 (GRCm39) missense probably benign
R3113:Lyst UTSW 13 13,844,512 (GRCm39) missense probably benign 0.12
R3406:Lyst UTSW 13 13,809,815 (GRCm39) missense possibly damaging 0.56
R3972:Lyst UTSW 13 13,881,210 (GRCm39) missense possibly damaging 0.67
R3978:Lyst UTSW 13 13,808,753 (GRCm39) missense possibly damaging 0.82
R4032:Lyst UTSW 13 13,791,250 (GRCm39) missense probably damaging 1.00
R4192:Lyst UTSW 13 13,915,098 (GRCm39) missense probably damaging 1.00
R4206:Lyst UTSW 13 13,810,574 (GRCm39) missense probably benign 0.03
R4298:Lyst UTSW 13 13,809,472 (GRCm39) missense probably damaging 1.00
R4344:Lyst UTSW 13 13,873,051 (GRCm39) missense probably benign 0.06
R4441:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4445:Lyst UTSW 13 13,884,149 (GRCm39) missense probably benign 0.42
R4477:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4493:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4494:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4495:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4622:Lyst UTSW 13 13,848,983 (GRCm39) missense probably benign 0.01
R4638:Lyst UTSW 13 13,871,379 (GRCm39) splice site probably null
R4658:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4675:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4719:Lyst UTSW 13 13,824,935 (GRCm39) missense probably benign
R4729:Lyst UTSW 13 13,812,486 (GRCm39) missense probably damaging 1.00
R4774:Lyst UTSW 13 13,915,182 (GRCm39) missense probably damaging 1.00
R4811:Lyst UTSW 13 13,951,685 (GRCm39) missense probably benign 0.33
R4877:Lyst UTSW 13 13,857,734 (GRCm39) missense probably damaging 1.00
R4920:Lyst UTSW 13 13,821,645 (GRCm39) missense possibly damaging 0.79
R4933:Lyst UTSW 13 13,933,963 (GRCm39) missense probably benign 0.12
R4933:Lyst UTSW 13 13,812,349 (GRCm39) missense probably damaging 0.98
R4958:Lyst UTSW 13 13,810,048 (GRCm39) missense probably benign 0.00
R4982:Lyst UTSW 13 13,900,539 (GRCm39) missense probably damaging 1.00
R4992:Lyst UTSW 13 13,835,748 (GRCm39) missense probably damaging 1.00
R5024:Lyst UTSW 13 13,808,989 (GRCm39) missense probably benign
R5049:Lyst UTSW 13 13,810,649 (GRCm39) missense probably damaging 1.00
R5079:Lyst UTSW 13 13,931,938 (GRCm39) missense probably benign 0.08
R5254:Lyst UTSW 13 13,857,655 (GRCm39) missense probably benign 0.00
R5266:Lyst UTSW 13 13,835,555 (GRCm39) missense probably damaging 1.00
R5279:Lyst UTSW 13 13,823,387 (GRCm39) nonsense probably null
R5285:Lyst UTSW 13 13,809,011 (GRCm39) missense probably benign 0.01
R5364:Lyst UTSW 13 13,831,439 (GRCm39) missense probably benign 0.35
R5435:Lyst UTSW 13 13,951,649 (GRCm39) missense possibly damaging 0.64
R5516:Lyst UTSW 13 13,818,707 (GRCm39) missense probably benign 0.10
R5524:Lyst UTSW 13 13,921,364 (GRCm39) missense probably benign 0.03
R5591:Lyst UTSW 13 13,917,918 (GRCm39) missense probably damaging 0.99
R5592:Lyst UTSW 13 13,917,918 (GRCm39) missense probably damaging 0.99
R5593:Lyst UTSW 13 13,917,918 (GRCm39) missense probably damaging 0.99
R5594:Lyst UTSW 13 13,917,918 (GRCm39) missense probably damaging 0.99
R5594:Lyst UTSW 13 13,933,982 (GRCm39) missense probably benign 0.00
R5644:Lyst UTSW 13 13,812,081 (GRCm39) missense possibly damaging 0.58
R5659:Lyst UTSW 13 13,809,212 (GRCm39) missense possibly damaging 0.58
R5741:Lyst UTSW 13 13,808,615 (GRCm39) missense probably benign 0.44
R5908:Lyst UTSW 13 13,871,346 (GRCm39) nonsense probably null
R5969:Lyst UTSW 13 13,862,398 (GRCm39) splice site probably null
R6128:Lyst UTSW 13 13,933,964 (GRCm39) missense possibly damaging 0.67
R6271:Lyst UTSW 13 13,833,339 (GRCm39) missense probably benign 0.30
R6315:Lyst UTSW 13 13,818,089 (GRCm39) missense probably benign
R6318:Lyst UTSW 13 13,917,896 (GRCm39) missense possibly damaging 0.88
R6555:Lyst UTSW 13 13,823,510 (GRCm39) missense probably benign 0.01
R6663:Lyst UTSW 13 13,838,701 (GRCm39) splice site probably null
R6701:Lyst UTSW 13 13,856,070 (GRCm39) missense probably benign 0.06
R6711:Lyst UTSW 13 13,809,820 (GRCm39) missense possibly damaging 0.80
R6909:Lyst UTSW 13 13,917,960 (GRCm39) missense probably damaging 1.00
R6915:Lyst UTSW 13 13,900,629 (GRCm39) missense probably benign 0.01
R6929:Lyst UTSW 13 13,917,909 (GRCm39) missense probably damaging 1.00
R6960:Lyst UTSW 13 13,808,663 (GRCm39) missense probably benign 0.12
R7018:Lyst UTSW 13 13,918,044 (GRCm39) critical splice donor site probably null
R7037:Lyst UTSW 13 13,791,251 (GRCm39) missense probably damaging 1.00
R7045:Lyst UTSW 13 13,812,293 (GRCm39) missense probably damaging 1.00
R7045:Lyst UTSW 13 13,809,485 (GRCm39) missense probably benign 0.34
R7070:Lyst UTSW 13 13,932,029 (GRCm39) missense probably benign 0.23
R7188:Lyst UTSW 13 13,926,675 (GRCm39) missense possibly damaging 0.66
R7201:Lyst UTSW 13 13,883,885 (GRCm39) nonsense probably null
R7210:Lyst UTSW 13 13,831,568 (GRCm39) missense probably damaging 1.00
R7229:Lyst UTSW 13 13,818,094 (GRCm39) missense probably benign 0.00
R7293:Lyst UTSW 13 13,854,822 (GRCm39) missense probably benign 0.01
R7318:Lyst UTSW 13 13,932,028 (GRCm39) missense probably benign 0.13
R7344:Lyst UTSW 13 13,881,140 (GRCm39) missense probably benign
R7426:Lyst UTSW 13 13,812,109 (GRCm39) missense probably benign
R7522:Lyst UTSW 13 13,821,668 (GRCm39) nonsense probably null
R7583:Lyst UTSW 13 13,810,472 (GRCm39) missense probably damaging 1.00
R7606:Lyst UTSW 13 13,812,060 (GRCm39) missense probably damaging 1.00
R7636:Lyst UTSW 13 13,791,332 (GRCm39) critical splice donor site probably null
R7658:Lyst UTSW 13 13,905,061 (GRCm39) missense possibly damaging 0.63
R7685:Lyst UTSW 13 13,844,450 (GRCm39) missense probably benign 0.00
R7689:Lyst UTSW 13 13,857,808 (GRCm39) critical splice donor site probably null
R7765:Lyst UTSW 13 13,884,117 (GRCm39) missense possibly damaging 0.75
R7779:Lyst UTSW 13 13,809,128 (GRCm39) missense probably damaging 1.00
R7871:Lyst UTSW 13 13,810,637 (GRCm39) nonsense probably null
R7872:Lyst UTSW 13 13,810,450 (GRCm39) missense probably benign 0.14
R7884:Lyst UTSW 13 13,882,268 (GRCm39) missense probably benign 0.09
R7890:Lyst UTSW 13 13,915,154 (GRCm39) missense probably damaging 0.99
R7916:Lyst UTSW 13 13,821,657 (GRCm39) missense possibly damaging 0.64
R7948:Lyst UTSW 13 13,921,174 (GRCm39) missense possibly damaging 0.59
R7956:Lyst UTSW 13 13,815,788 (GRCm39) missense possibly damaging 0.80
R8048:Lyst UTSW 13 13,862,230 (GRCm39) missense probably benign 0.12
R8085:Lyst UTSW 13 13,808,894 (GRCm39) missense probably damaging 0.98
R8165:Lyst UTSW 13 13,872,945 (GRCm39) missense probably damaging 0.99
R8235:Lyst UTSW 13 13,935,323 (GRCm39) missense possibly damaging 0.69
R8237:Lyst UTSW 13 13,826,317 (GRCm39) missense probably benign 0.00
R8275:Lyst UTSW 13 13,950,667 (GRCm39) missense probably benign 0.02
R8300:Lyst UTSW 13 13,838,643 (GRCm39) missense possibly damaging 0.79
R8350:Lyst UTSW 13 13,824,973 (GRCm39) nonsense probably null
R8526:Lyst UTSW 13 13,935,391 (GRCm39) missense probably damaging 0.99
R8551:Lyst UTSW 13 13,808,645 (GRCm39) missense possibly damaging 0.77
R8723:Lyst UTSW 13 13,887,342 (GRCm39) missense possibly damaging 0.89
R8772:Lyst UTSW 13 13,812,077 (GRCm39) nonsense probably null
R8778:Lyst UTSW 13 13,903,152 (GRCm39) missense possibly damaging 0.89
R8778:Lyst UTSW 13 13,810,361 (GRCm39) missense possibly damaging 0.89
R8801:Lyst UTSW 13 13,835,595 (GRCm39) missense probably benign 0.10
R8837:Lyst UTSW 13 13,852,548 (GRCm39) missense probably benign
R8874:Lyst UTSW 13 13,812,147 (GRCm39) missense probably benign
R8878:Lyst UTSW 13 13,815,661 (GRCm39) missense probably benign 0.00
R8891:Lyst UTSW 13 13,887,435 (GRCm39) missense possibly damaging 0.67
R9077:Lyst UTSW 13 13,857,693 (GRCm39) missense probably benign 0.02
R9127:Lyst UTSW 13 13,808,827 (GRCm39) missense probably damaging 1.00
R9143:Lyst UTSW 13 13,835,750 (GRCm39) missense probably damaging 0.98
R9216:Lyst UTSW 13 13,823,188 (GRCm39) missense probably benign
R9217:Lyst UTSW 13 13,871,245 (GRCm39) missense probably benign 0.01
R9291:Lyst UTSW 13 13,883,938 (GRCm39) missense probably benign 0.01
R9302:Lyst UTSW 13 13,904,947 (GRCm39) missense possibly damaging 0.46
R9370:Lyst UTSW 13 13,935,333 (GRCm39) missense probably damaging 1.00
R9402:Lyst UTSW 13 13,812,463 (GRCm39) missense probably benign
R9457:Lyst UTSW 13 13,862,330 (GRCm39) missense possibly damaging 0.83
R9481:Lyst UTSW 13 13,857,653 (GRCm39) missense possibly damaging 0.68
R9563:Lyst UTSW 13 13,812,408 (GRCm39) missense probably benign 0.36
R9623:Lyst UTSW 13 13,852,587 (GRCm39) missense probably benign
R9661:Lyst UTSW 13 13,808,779 (GRCm39) missense probably benign 0.01
R9682:Lyst UTSW 13 13,831,526 (GRCm39) missense probably benign 0.21
R9743:Lyst UTSW 13 13,809,323 (GRCm39) missense possibly damaging 0.67
R9801:Lyst UTSW 13 13,809,290 (GRCm39) missense probably damaging 0.97
RF001:Lyst UTSW 13 13,810,426 (GRCm39) missense probably benign
RF002:Lyst UTSW 13 13,808,948 (GRCm39) missense probably benign 0.05
X0024:Lyst UTSW 13 13,809,033 (GRCm39) missense probably benign 0.00
X0026:Lyst UTSW 13 13,926,555 (GRCm39) missense probably damaging 0.99
Z1088:Lyst UTSW 13 13,918,018 (GRCm39) missense probably benign 0.09
Z1176:Lyst UTSW 13 13,951,664 (GRCm39) missense probably benign 0.27
Z1176:Lyst UTSW 13 13,814,692 (GRCm39) missense probably damaging 1.00
Z1177:Lyst UTSW 13 13,854,719 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TAGACTTGGAGACACGACCCAAGG -3'
(R):5'- TAGTCCACACAGTGGTAGGTGAGC -3'

Sequencing Primer
(F):5'- CCCTTTTTAGCAATAAGACAAAGGC -3'
(R):5'- AGCTCTGTCTACATTGGATTTACG -3'
Posted On 2013-05-23