Incidental Mutation 'R5228:Gli2'
ID402713
Institutional Source Beutler Lab
Gene Symbol Gli2
Ensembl Gene ENSMUSG00000048402
Gene NameGLI-Kruppel family member GLI2
Synonyms
MMRRC Submission 042801-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5228 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location118834132-119053619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118836206 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1405 (D1405V)
Ref Sequence ENSEMBL: ENSMUSP00000054837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062483]
Predicted Effect probably damaging
Transcript: ENSMUST00000062483
AA Change: D1405V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054837
Gene: ENSMUSG00000048402
AA Change: D1405V

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 36 43 N/A INTRINSIC
low complexity region 259 278 N/A INTRINSIC
ZnF_C2H2 417 442 4.98e-1 SMART
ZnF_C2H2 450 477 6.57e0 SMART
ZnF_C2H2 483 507 2.09e-3 SMART
ZnF_C2H2 513 538 4.17e-3 SMART
ZnF_C2H2 544 569 1.84e-4 SMART
low complexity region 637 657 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
low complexity region 930 945 N/A INTRINSIC
low complexity region 1035 1053 N/A INTRINSIC
low complexity region 1428 1435 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger protein subclass of the Gli family. Members of this subclass are characterized as transcription factors which bind DNA through zinc finger motifs. These motifs contain conserved H-C links. Gli family zinc finger proteins are mediators of Sonic hedgehog (Shh) signaling and they are implicated as potent oncogenes in the embryonal carcinoma cell. The protein encoded by this gene localizes to the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. The encoded protein is associated with several phenotypes- Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit skeletal malformations, absence of floorplate and foregut, lung and anorectal defects, and altered commissural neuron guidance. Most mutants die before embryonic day 18.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T C 13: 12,288,659 probably null Het
Agrn G T 4: 156,166,946 A1864D probably damaging Het
Ahnak2 A G 12: 112,775,386 S751P probably benign Het
Aifm2 T C 10: 61,732,417 V201A probably damaging Het
C1rl C T 6: 124,508,468 A266V probably damaging Het
Clec2h G T 6: 128,674,786 A153S probably benign Het
Dnah7a T C 1: 53,437,609 probably null Het
Frmpd1 T C 4: 45,284,322 S1048P probably damaging Het
Galnt16 A T 12: 80,584,048 D300V probably damaging Het
Gbp8 G T 5: 105,016,185 Q416K probably benign Het
Gldn C T 9: 54,334,719 T319I probably damaging Het
Gtsf2 A G 15: 103,444,615 Y45H probably damaging Het
Hmcn1 C A 1: 150,646,701 V3483F probably benign Het
Hspa12b T C 2: 131,142,964 V385A possibly damaging Het
Ibtk T C 9: 85,726,689 E390G possibly damaging Het
Inpp4b C G 8: 81,768,115 P53R probably damaging Het
Ipo7 T A 7: 110,046,762 C504S probably benign Het
Iws1 A G 18: 32,088,261 D549G probably damaging Het
Kcnh4 T C 11: 100,746,896 D645G probably damaging Het
Klhl40 A G 9: 121,777,801 E9G probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Morc2a T C 11: 3,685,439 V810A probably damaging Het
Myo1e C A 9: 70,322,358 probably null Het
N4bp2 T C 5: 65,807,518 V970A probably benign Het
Pira2 T A 7: 3,844,374 K105N probably benign Het
Pml G A 9: 58,219,997 R61C probably damaging Het
Pms2 T C 5: 143,923,597 L76P probably damaging Het
Rlbp1 T G 7: 79,377,334 T193P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGG 11: 3,153,384 probably benign Homo
Sh3rf2 T C 18: 42,153,181 S548P possibly damaging Het
Slc4a4 A G 5: 89,156,525 D609G possibly damaging Het
Slk A T 19: 47,625,332 I876F probably damaging Het
Tcf20 G A 15: 82,855,955 P432S probably benign Het
Tenm3 A C 8: 48,236,355 S2066A probably damaging Het
Topors G C 4: 40,262,367 L306V probably damaging Het
Trappc9 A T 15: 73,057,995 S171T probably damaging Het
Ube2m G T 7: 13,035,770 probably benign Het
Vmn1r37 T C 6: 66,732,298 *266Q probably null Het
Vmn2r34 T C 7: 7,672,341 T683A probably damaging Het
Other mutations in Gli2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Gli2 APN 1 118836891 missense probably benign
IGL01686:Gli2 APN 1 118848435 missense probably damaging 1.00
IGL01925:Gli2 APN 1 118853376 missense probably damaging 1.00
IGL02106:Gli2 APN 1 118836735 missense probably benign
IGL02202:Gli2 APN 1 118836866 missense probably damaging 0.96
IGL02255:Gli2 APN 1 118844349 critical splice donor site probably null
IGL02437:Gli2 APN 1 118836003 missense probably damaging 1.00
IGL02615:Gli2 APN 1 118844398 missense probably damaging 1.00
IGL02817:Gli2 APN 1 118836371 missense possibly damaging 0.55
IGL03294:Gli2 APN 1 118837436 missense probably benign
fairyfly UTSW 1 118840490 missense possibly damaging 0.93
flea UTSW 1 118835925 missense probably damaging 0.99
patu_digua UTSW 1 118837506 missense probably damaging 1.00
R0055:Gli2 UTSW 1 118890408 intron probably benign
R0055:Gli2 UTSW 1 118890408 intron probably benign
R0164:Gli2 UTSW 1 118890283 intron probably benign
R0233:Gli2 UTSW 1 118835925 missense probably damaging 0.99
R0233:Gli2 UTSW 1 118835925 missense probably damaging 0.99
R0308:Gli2 UTSW 1 118842062 missense probably benign 0.00
R0418:Gli2 UTSW 1 118840490 missense possibly damaging 0.93
R0558:Gli2 UTSW 1 118837649 missense probably benign 0.01
R0600:Gli2 UTSW 1 118840389 missense probably damaging 1.00
R0630:Gli2 UTSW 1 118841918 missense possibly damaging 0.52
R0690:Gli2 UTSW 1 118844460 missense probably damaging 1.00
R0942:Gli2 UTSW 1 118837506 missense probably damaging 1.00
R1061:Gli2 UTSW 1 118854517 missense possibly damaging 0.71
R1104:Gli2 UTSW 1 118853350 missense probably damaging 1.00
R1141:Gli2 UTSW 1 118837937 missense possibly damaging 0.71
R1344:Gli2 UTSW 1 118841936 missense probably damaging 0.98
R1418:Gli2 UTSW 1 118841936 missense probably damaging 0.98
R1565:Gli2 UTSW 1 118841930 missense possibly damaging 0.57
R1605:Gli2 UTSW 1 118854560 missense probably damaging 1.00
R1640:Gli2 UTSW 1 118836524 missense possibly damaging 0.83
R1728:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1728:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1729:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1729:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1730:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1730:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1739:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1739:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1762:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1762:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1783:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1783:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1785:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1785:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1874:Gli2 UTSW 1 119002049 missense possibly damaging 0.83
R1969:Gli2 UTSW 1 118837700 missense probably benign 0.00
R2199:Gli2 UTSW 1 118837648 missense possibly damaging 0.95
R2377:Gli2 UTSW 1 118837125 missense possibly damaging 0.90
R2883:Gli2 UTSW 1 118868144 missense probably damaging 0.97
R2924:Gli2 UTSW 1 118836359 missense probably benign 0.00
R4363:Gli2 UTSW 1 118853370 missense probably benign 0.00
R4430:Gli2 UTSW 1 118837244 missense probably benign
R4463:Gli2 UTSW 1 118836008 missense probably damaging 1.00
R4583:Gli2 UTSW 1 118842068 missense probably benign
R4613:Gli2 UTSW 1 118837511 missense probably damaging 1.00
R4674:Gli2 UTSW 1 118836029 missense probably damaging 1.00
R4735:Gli2 UTSW 1 118840322 missense probably damaging 1.00
R4770:Gli2 UTSW 1 118982588 intron probably benign
R4936:Gli2 UTSW 1 118836140 missense probably benign
R5137:Gli2 UTSW 1 118855503 missense probably damaging 1.00
R5318:Gli2 UTSW 1 118844470 missense probably damaging 1.00
R5619:Gli2 UTSW 1 118836755 missense probably benign 0.27
R5661:Gli2 UTSW 1 118853302 nonsense probably null
R6005:Gli2 UTSW 1 118842064 missense probably damaging 1.00
R6012:Gli2 UTSW 1 118837715 missense probably damaging 0.99
R6341:Gli2 UTSW 1 118836224 missense probably damaging 1.00
R6357:Gli2 UTSW 1 118841959 missense probably damaging 1.00
R6425:Gli2 UTSW 1 118835894 nonsense probably null
R6513:Gli2 UTSW 1 118855554 missense probably damaging 1.00
R6802:Gli2 UTSW 1 118842065 missense probably damaging 1.00
R6889:Gli2 UTSW 1 118844416 missense probably damaging 1.00
R7259:Gli2 UTSW 1 118836534 missense probably benign
R7378:Gli2 UTSW 1 118848492 missense probably damaging 1.00
R7420:Gli2 UTSW 1 118835939 missense probably benign 0.00
R7489:Gli2 UTSW 1 118838175 missense probably benign 0.00
R7498:Gli2 UTSW 1 118835835 missense possibly damaging 0.89
X0028:Gli2 UTSW 1 118837277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCATCAAAGTCAATCTGGGG -3'
(R):5'- TTTGGTCTCATGCAGCCTCG -3'

Sequencing Primer
(F):5'- TGTCTGAGCAAGCTTGTG -3'
(R):5'- TCATGCAGCCTCGGCCAC -3'
Posted On2016-07-22