Incidental Mutation 'R5228:C1rl'
ID402728
Institutional Source Beutler Lab
Gene Symbol C1rl
Ensembl Gene ENSMUSG00000038527
Gene Namecomplement component 1, r subcomponent-like
SynonymsC1rl1, C1r-LP
MMRRC Submission 042801-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5228 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location124493113-124510643 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 124508468 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 266 (A266V)
Ref Sequence ENSEMBL: ENSMUSP00000042883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049124] [ENSMUST00000068593]
Predicted Effect probably damaging
Transcript: ENSMUST00000049124
AA Change: A266V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042883
Gene: ENSMUSG00000038527
AA Change: A266V

DomainStartEndE-ValueType
CUB 42 166 3.19e-18 SMART
Tryp_SPc 239 474 1.25e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068593
SMART Domains Protein: ENSMUSP00000063707
Gene: ENSMUSG00000055172

DomainStartEndE-ValueType
CUB 14 140 1.56e-35 SMART
EGF_CA 141 189 1.88e-10 SMART
CUB 192 304 4.74e-35 SMART
CCP 308 370 5.56e-9 SMART
CCP 375 446 1.53e-6 SMART
Tryp_SPc 462 699 2.7e-71 SMART
Meta Mutation Damage Score 0.3235 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T C 13: 12,288,659 probably null Het
Agrn G T 4: 156,166,946 A1864D probably damaging Het
Ahnak2 A G 12: 112,775,386 S751P probably benign Het
Aifm2 T C 10: 61,732,417 V201A probably damaging Het
Clec2h G T 6: 128,674,786 A153S probably benign Het
Dnah7a T C 1: 53,437,609 probably null Het
Frmpd1 T C 4: 45,284,322 S1048P probably damaging Het
Galnt16 A T 12: 80,584,048 D300V probably damaging Het
Gbp8 G T 5: 105,016,185 Q416K probably benign Het
Gldn C T 9: 54,334,719 T319I probably damaging Het
Gli2 T A 1: 118,836,206 D1405V probably damaging Het
Gtsf2 A G 15: 103,444,615 Y45H probably damaging Het
Hmcn1 C A 1: 150,646,701 V3483F probably benign Het
Hspa12b T C 2: 131,142,964 V385A possibly damaging Het
Ibtk T C 9: 85,726,689 E390G possibly damaging Het
Inpp4b C G 8: 81,768,115 P53R probably damaging Het
Ipo7 T A 7: 110,046,762 C504S probably benign Het
Iws1 A G 18: 32,088,261 D549G probably damaging Het
Kcnh4 T C 11: 100,746,896 D645G probably damaging Het
Klhl40 A G 9: 121,777,801 E9G probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Morc2a T C 11: 3,685,439 V810A probably damaging Het
Myo1e C A 9: 70,322,358 probably null Het
N4bp2 T C 5: 65,807,518 V970A probably benign Het
Pira2 T A 7: 3,844,374 K105N probably benign Het
Pml G A 9: 58,219,997 R61C probably damaging Het
Pms2 T C 5: 143,923,597 L76P probably damaging Het
Rlbp1 T G 7: 79,377,334 T193P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGG 11: 3,153,384 probably benign Homo
Sh3rf2 T C 18: 42,153,181 S548P possibly damaging Het
Slc4a4 A G 5: 89,156,525 D609G possibly damaging Het
Slk A T 19: 47,625,332 I876F probably damaging Het
Tcf20 G A 15: 82,855,955 P432S probably benign Het
Tenm3 A C 8: 48,236,355 S2066A probably damaging Het
Topors G C 4: 40,262,367 L306V probably damaging Het
Trappc9 A T 15: 73,057,995 S171T probably damaging Het
Ube2m G T 7: 13,035,770 probably benign Het
Vmn1r37 T C 6: 66,732,298 *266Q probably null Het
Vmn2r34 T C 7: 7,672,341 T683A probably damaging Het
Other mutations in C1rl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02435:C1rl APN 6 124508873 missense probably damaging 1.00
IGL02549:C1rl APN 6 124493837 missense possibly damaging 0.76
IGL02581:C1rl APN 6 124493154 missense possibly damaging 0.83
IGL02642:C1rl APN 6 124493847 missense possibly damaging 0.60
IGL02950:C1rl APN 6 124508861 missense probably damaging 1.00
IGL02980:C1rl UTSW 6 124508528 missense probably benign 0.00
R0699:C1rl UTSW 6 124508636 missense probably benign 0.14
R0848:C1rl UTSW 6 124508506 missense probably benign 0.29
R1221:C1rl UTSW 6 124493981 missense probably benign 0.43
R1654:C1rl UTSW 6 124493910 missense probably damaging 0.97
R1957:C1rl UTSW 6 124509062 missense probably damaging 1.00
R2055:C1rl UTSW 6 124493822 missense probably benign 0.01
R2120:C1rl UTSW 6 124508713 missense probably damaging 0.99
R2262:C1rl UTSW 6 124506948 missense probably damaging 0.99
R2363:C1rl UTSW 6 124509110 missense probably benign 0.13
R3933:C1rl UTSW 6 124508822 nonsense probably null
R4824:C1rl UTSW 6 124509081 nonsense probably null
R5414:C1rl UTSW 6 124508468 missense probably damaging 1.00
R6008:C1rl UTSW 6 124493188 missense probably benign 0.00
R6467:C1rl UTSW 6 124508576 missense probably benign 0.03
R6549:C1rl UTSW 6 124508528 missense probably benign 0.00
R6609:C1rl UTSW 6 124508624 missense probably benign 0.44
R6998:C1rl UTSW 6 124508902 missense probably damaging 1.00
R7037:C1rl UTSW 6 124508639 missense probably damaging 1.00
Z1088:C1rl UTSW 6 124508742 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGTCTCTAATCTAATCTCTCACGG -3'
(R):5'- GGACTCTCTGCTCAAGTTCC -3'

Sequencing Primer
(F):5'- AATCTAATCTCTCACGGTTGTTGATC -3'
(R):5'- TCTGCTCAAGTTCCAGGAGAG -3'
Posted On2016-07-22