Incidental Mutation 'R5228:Ipo7'
ID402734
Institutional Source Beutler Lab
Gene Symbol Ipo7
Ensembl Gene ENSMUSG00000066232
Gene Nameimportin 7
SynonymsA330055O14Rik, Imp7, RanBP7
MMRRC Submission 042801-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R5228 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location110018274-110056609 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110046762 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 504 (C504S)
Ref Sequence ENSEMBL: ENSMUSP00000081782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084731] [ENSMUST00000208951]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082517
Predicted Effect probably benign
Transcript: ENSMUST00000084731
AA Change: C504S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000081782
Gene: ENSMUSG00000066232
AA Change: C504S

DomainStartEndE-ValueType
IBN_N 22 101 3.06e-15 SMART
Pfam:Cse1 168 452 2.8e-12 PFAM
low complexity region 701 712 N/A INTRINSIC
low complexity region 881 900 N/A INTRINSIC
low complexity region 923 939 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208821
Predicted Effect probably benign
Transcript: ENSMUST00000208951
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The importin-alpha/beta complex and the GTPase Ran mediate nuclear import of proteins with a classical nuclear localization signal. The protein encoded by this gene is a member of a class of approximately 20 potential Ran targets that share a sequence motif related to the Ran-binding site of importin-beta. Similar to importin-beta, this protein prevents the activation of Ran's GTPase by RanGAP1 and inhibits nucleotide exchange on RanGTP, and also binds directly to nuclear pore complexes where it competes for binding sites with importin-beta and transportin. This protein has a Ran-dependent transport cycle and it can cross the nuclear envelope rapidly and in both directions. At least four importin beta-like transport receptors, namely importin beta itself, transportin, RanBP5 and RanBP7, directly bind and import ribosomal proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T C 13: 12,288,659 probably null Het
Agrn G T 4: 156,166,946 A1864D probably damaging Het
Ahnak2 A G 12: 112,775,386 S751P probably benign Het
Aifm2 T C 10: 61,732,417 V201A probably damaging Het
C1rl C T 6: 124,508,468 A266V probably damaging Het
Clec2h G T 6: 128,674,786 A153S probably benign Het
Dnah7a T C 1: 53,437,609 probably null Het
Frmpd1 T C 4: 45,284,322 S1048P probably damaging Het
Galnt16 A T 12: 80,584,048 D300V probably damaging Het
Gbp8 G T 5: 105,016,185 Q416K probably benign Het
Gldn C T 9: 54,334,719 T319I probably damaging Het
Gli2 T A 1: 118,836,206 D1405V probably damaging Het
Gtsf2 A G 15: 103,444,615 Y45H probably damaging Het
Hmcn1 C A 1: 150,646,701 V3483F probably benign Het
Hspa12b T C 2: 131,142,964 V385A possibly damaging Het
Ibtk T C 9: 85,726,689 E390G possibly damaging Het
Inpp4b C G 8: 81,768,115 P53R probably damaging Het
Iws1 A G 18: 32,088,261 D549G probably damaging Het
Kcnh4 T C 11: 100,746,896 D645G probably damaging Het
Klhl40 A G 9: 121,777,801 E9G probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Morc2a T C 11: 3,685,439 V810A probably damaging Het
Myo1e C A 9: 70,322,358 probably null Het
N4bp2 T C 5: 65,807,518 V970A probably benign Het
Pira2 T A 7: 3,844,374 K105N probably benign Het
Pml G A 9: 58,219,997 R61C probably damaging Het
Pms2 T C 5: 143,923,597 L76P probably damaging Het
Rlbp1 T G 7: 79,377,334 T193P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGG 11: 3,153,384 probably benign Homo
Sh3rf2 T C 18: 42,153,181 S548P possibly damaging Het
Slc4a4 A G 5: 89,156,525 D609G possibly damaging Het
Slk A T 19: 47,625,332 I876F probably damaging Het
Tcf20 G A 15: 82,855,955 P432S probably benign Het
Tenm3 A C 8: 48,236,355 S2066A probably damaging Het
Topors G C 4: 40,262,367 L306V probably damaging Het
Trappc9 A T 15: 73,057,995 S171T probably damaging Het
Ube2m G T 7: 13,035,770 probably benign Het
Vmn1r37 T C 6: 66,732,298 *266Q probably null Het
Vmn2r34 T C 7: 7,672,341 T683A probably damaging Het
Other mutations in Ipo7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Ipo7 APN 7 110029848 intron probably benign
IGL02472:Ipo7 APN 7 110040853 missense probably damaging 1.00
IGL02502:Ipo7 APN 7 110051050 missense probably damaging 1.00
IGL02514:Ipo7 APN 7 110048828 missense possibly damaging 0.78
IGL02535:Ipo7 APN 7 110054026 missense probably damaging 0.98
IGL02961:Ipo7 APN 7 110047016 missense probably benign 0.02
R0089:Ipo7 UTSW 7 110050765 intron probably benign
R0355:Ipo7 UTSW 7 110049661 missense probably benign 0.00
R0565:Ipo7 UTSW 7 110049593 intron probably benign
R1342:Ipo7 UTSW 7 110029804 missense possibly damaging 0.82
R1405:Ipo7 UTSW 7 110029841 missense probably benign 0.03
R1405:Ipo7 UTSW 7 110039249 missense probably damaging 0.97
R1405:Ipo7 UTSW 7 110029841 missense probably benign 0.03
R1405:Ipo7 UTSW 7 110039249 missense probably damaging 0.97
R1791:Ipo7 UTSW 7 110027132 missense probably damaging 0.98
R1838:Ipo7 UTSW 7 110042109 missense probably damaging 1.00
R2116:Ipo7 UTSW 7 110051118 missense probably damaging 0.99
R2120:Ipo7 UTSW 7 110049631 missense probably damaging 1.00
R4366:Ipo7 UTSW 7 110029712 missense possibly damaging 0.58
R4366:Ipo7 UTSW 7 110048216 missense possibly damaging 0.88
R4805:Ipo7 UTSW 7 110051484 missense probably benign 0.16
R5903:Ipo7 UTSW 7 110050813 missense probably damaging 1.00
R5976:Ipo7 UTSW 7 110048807 missense probably damaging 1.00
R6254:Ipo7 UTSW 7 110049060 missense probably benign 0.00
R6335:Ipo7 UTSW 7 110018468 missense possibly damaging 0.92
R6360:Ipo7 UTSW 7 110027129 missense probably damaging 1.00
R6776:Ipo7 UTSW 7 110047065 missense probably damaging 0.98
R7132:Ipo7 UTSW 7 110054047 missense probably benign 0.17
R7329:Ipo7 UTSW 7 110049017 missense possibly damaging 0.94
R7491:Ipo7 UTSW 7 110039194 missense possibly damaging 0.91
R7763:Ipo7 UTSW 7 110052799 missense possibly damaging 0.62
R8070:Ipo7 UTSW 7 110052807 missense probably benign 0.01
RF017:Ipo7 UTSW 7 110048794 missense probably benign 0.00
X0062:Ipo7 UTSW 7 110052886 missense probably damaging 1.00
X0066:Ipo7 UTSW 7 110052734 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACTGGCCAGCCTCCAAATTC -3'
(R):5'- CAGCTATTACGTTGGGTATAGAAAC -3'

Sequencing Primer
(F):5'- TGTAATGTCTTCAGATACACACACAC -3'
(R):5'- ACAACAAAAACCAAGGTGTTTTC -3'
Posted On2016-07-22