Mutagenetix > Incidental Mutation

Incidental Mutation 'R5281:Fap'

402766

Institutional Source

Beutler Lab

Gene Symbol

Fap

Ensembl Gene

ENSMUSG00000000392

Gene Name

fibroblast activation protein

Synonyms

MMRRC Submission

042866-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5281 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

62500943-62574075 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 62532961 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000134386 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000402] [ENSMUST00000000402] [ENSMUST00000102732] [ENSMUST00000174234] [ENSMUST00000174234] [ENSMUST00000174448] [ENSMUST00000174448]

AlphaFold

P97321

Predicted Effect

probably null
Transcript: ENSMUST00000000402

SMART Domains

Protein: ENSMUSP00000000402
Gene: ENSMUSG00000000392

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
Pfam:DPPIV_N	73	440	2e-110	PFAM
Pfam:Abhydrolase_5	504	719	2.4e-12	PFAM
Pfam:Abhydrolase_6	515	703	2.3e-10	PFAM
Pfam:Peptidase_S9	520	727	9.4e-60	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000000402

SMART Domains

Protein: ENSMUSP00000000402
Gene: ENSMUSG00000000392

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
Pfam:DPPIV_N	73	440	2e-110	PFAM
Pfam:Abhydrolase_5	504	719	2.4e-12	PFAM
Pfam:Abhydrolase_6	515	703	2.3e-10	PFAM
Pfam:Peptidase_S9	520	727	9.4e-60	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000102732

SMART Domains

Protein: ENSMUSP00000099793
Gene: ENSMUSG00000000392

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:DPPIV_N	106	473	1.9e-106	PFAM
Pfam:Abhydrolase_5	537	752	2.9e-12	PFAM
Pfam:Peptidase_S9	553	760	1.5e-61	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136297

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152085

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172676

Predicted Effect

probably null
Transcript: ENSMUST00000174234

SMART Domains

Protein: ENSMUSP00000133792
Gene: ENSMUSG00000000392

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:DPPIV_N	82	448	4.1e-108	PFAM
Pfam:Abhydrolase_5	512	727	6.4e-12	PFAM
Pfam:Abhydrolase_6	523	711	8.9e-10	PFAM
Pfam:Peptidase_S9	528	735	5.9e-59	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000174234

SMART Domains

Protein: ENSMUSP00000133792
Gene: ENSMUSG00000000392

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:DPPIV_N	82	448	4.1e-108	PFAM
Pfam:Abhydrolase_5	512	727	6.4e-12	PFAM
Pfam:Abhydrolase_6	523	711	8.9e-10	PFAM
Pfam:Peptidase_S9	528	735	5.9e-59	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000174448

SMART Domains

Protein: ENSMUSP00000134386
Gene: ENSMUSG00000000392

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:DPPIV_N	101	468	2.2e-110	PFAM
Pfam:Abhydrolase_5	532	747	2.5e-12	PFAM
Pfam:Abhydrolase_6	541	731	2.4e-10	PFAM
Pfam:Peptidase_S9	548	755	1e-59	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000174448

SMART Domains

Protein: ENSMUSP00000134386
Gene: ENSMUSG00000000392

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:DPPIV_N	101	468	2.2e-110	PFAM
Pfam:Abhydrolase_5	532	747	2.5e-12	PFAM
Pfam:Abhydrolase_6	541	731	2.4e-10	PFAM
Pfam:Peptidase_S9	548	755	1e-59	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene belongs to the serine protease family. The encoded protein is an inducible cell-surface bound glycoprotein specifically expressed in tumor-associated fibroblasts and pericytes of epithelial tumors and has protease and gelatinase activity. The protein plays a role in remodeling of the extracellular matrix (ECM) and may affect tumorigenesis and tissue repair. Alternately spliced transcript variants of this gene are described in the literature (PMID 9139873), but the full-length sequence of these variants is not available. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for a targeted null mutations exhibit no discernable phenotype; mice are viable and fertile with no change in cancer susceptibility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl3	A	G	7: 82,528,934	H535R	probably damaging	Het
Aff4	A	G	11: 53,372,288	E45G	probably damaging	Het
Ano10	A	G	9: 122,261,486	S254P	probably damaging	Het
Arhgap21	T	A	2: 20,849,316	E1745V	probably damaging	Het
Atp10b	T	C	11: 43,254,336	L1302P	probably damaging	Het
Btn2a2	A	G	13: 23,478,832	V316A	probably damaging	Het
C2cd4c	G	A	10: 79,613,044	P90S	probably benign	Het
Cant1	A	T	11: 118,408,870	W255R	probably damaging	Het
Cenpe	A	C	3: 135,230,150	K449Q	possibly damaging	Het
Col4a4	C	T	1: 82,493,591	G681E	unknown	Het
Dmbt1	T	C	7: 131,082,619	V615A	probably damaging	Het
Dnajc5b	T	C	3: 19,610,560	V174A	probably benign	Het
Dst	C	A	1: 34,257,782	H5751N	probably benign	Het
Eif2d	A	G	1: 131,173,343	E562G	probably damaging	Het
Epha10	A	T	4: 124,913,988		probably benign	Het
Epha4	C	T	1: 77,374,867	G917D	probably benign	Het
Fsd2	T	C	7: 81,552,985	E282G	probably benign	Het
Gls	A	T	1: 52,191,157	M136K	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gusb	T	C	5: 129,998,526	T313A	probably benign	Het
Ints7	T	C	1: 191,615,771	Y752H	possibly damaging	Het
Krt17	G	A	11: 100,260,701	Q89*	probably null	Het
Mfsd4b4	T	C	10: 39,892,471	I209V	probably benign	Het
Nr0b2	A	G	4: 133,556,024	I191V	probably benign	Het
Olfr609	T	C	7: 103,491,973	I302V	probably benign	Het
Pcdhb21	T	C	18: 37,513,935	M39T	probably benign	Het
Pds5b	T	G	5: 150,746,608	Y354D	probably benign	Het
She	A	G	3: 89,849,581	D314G	probably benign	Het
Shpk	T	C	11: 73,215,120	M266T	probably benign	Het
Skint8	C	A	4: 111,950,193	L359M	probably damaging	Het
Slfn4	T	G	11: 83,187,199	V271G	probably damaging	Het
Slitrk6	C	T	14: 110,750,373	R634H	probably damaging	Het
Trrap	T	C	5: 144,813,503	F1555L	probably benign	Het
Vldlr	A	C	19: 27,244,231	E665D	probably benign	Het
Whrn	T	C	4: 63,418,427	T633A	probably benign	Het
Xylt2	A	G	11: 94,668,790	V342A	probably benign	Het
Zfp800	A	T	6: 28,243,166	V600E	probably benign	Het

Other mutations in Fap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Fap	APN	2	62524201	missense	possibly damaging	0.82
IGL01420:Fap	APN	2	62504502	splice site	probably benign
IGL01485:Fap	APN	2	62544311	missense	possibly damaging	0.80
IGL01987:Fap	APN	2	62528676	missense	probably damaging	1.00
IGL02198:Fap	APN	2	62554798	missense	probably benign
IGL02355:Fap	APN	2	62573498	missense	probably benign	0.02
IGL02362:Fap	APN	2	62573498	missense	probably benign	0.02
IGL03227:Fap	APN	2	62530763	critical splice acceptor site	probably null
IGL03266:Fap	APN	2	62537022	missense	probably benign
IGL03369:Fap	APN	2	62503355	splice site	probably benign
IGL03406:Fap	APN	2	62542122	splice site	probably benign
mnemosyne	UTSW	2	62528714	missense	probably damaging	1.00
R1467_Fap_571	UTSW	2	62517620	missense	probably benign	0.18
R4812_Fap_496	UTSW	2	62519021	missense	probably damaging	1.00
R5661_fap_070	UTSW	2	62536963	intron	probably benign
ANU74:Fap	UTSW	2	62547769	missense	probably damaging	1.00
R0254:Fap	UTSW	2	62503402	missense	probably damaging	1.00
R0842:Fap	UTSW	2	62537001	missense	probably damaging	1.00
R1467:Fap	UTSW	2	62517620	missense	probably benign	0.18
R1467:Fap	UTSW	2	62517620	missense	probably benign	0.18
R1591:Fap	UTSW	2	62553857	missense	probably damaging	0.99
R1671:Fap	UTSW	2	62553835	missense	possibly damaging	0.46
R1674:Fap	UTSW	2	62519005	missense	probably benign
R1795:Fap	UTSW	2	62548589	missense	probably damaging	1.00
R1869:Fap	UTSW	2	62528727	missense	probably damaging	1.00
R2032:Fap	UTSW	2	62542237	missense	probably benign	0.43
R2136:Fap	UTSW	2	62524207	missense	possibly damaging	0.94
R3546:Fap	UTSW	2	62519011	missense	probably damaging	1.00
R3547:Fap	UTSW	2	62519011	missense	probably damaging	1.00
R3771:Fap	UTSW	2	62533010	missense	probably damaging	1.00
R3801:Fap	UTSW	2	62546650	missense	probably benign	0.04
R3910:Fap	UTSW	2	62556104	missense	probably damaging	1.00
R4306:Fap	UTSW	2	62530707	critical splice donor site	probably null
R4323:Fap	UTSW	2	62503372	missense	probably damaging	0.97
R4517:Fap	UTSW	2	62530715	missense	probably benign	0.01
R4793:Fap	UTSW	2	62544369	missense	probably damaging	1.00
R4812:Fap	UTSW	2	62519021	missense	probably damaging	1.00
R4843:Fap	UTSW	2	62544374	missense	probably damaging	1.00
R5661:Fap	UTSW	2	62536963	intron	probably benign
R5696:Fap	UTSW	2	62502459	missense	probably damaging	1.00
R5750:Fap	UTSW	2	62528714	missense	probably damaging	1.00
R5898:Fap	UTSW	2	62573503	missense	probably benign
R5907:Fap	UTSW	2	62544356	missense	probably damaging	1.00
R5944:Fap	UTSW	2	62542261	missense	probably damaging	1.00
R5991:Fap	UTSW	2	62518521	missense	probably damaging	1.00
R6110:Fap	UTSW	2	62554770	missense	possibly damaging	0.91
R6270:Fap	UTSW	2	62547788	missense	probably damaging	0.98
R6505:Fap	UTSW	2	62546603	nonsense	probably null
R6631:Fap	UTSW	2	62503381	missense	probably damaging	1.00
R6896:Fap	UTSW	2	62504600	nonsense	probably null
R7138:Fap	UTSW	2	62542178	missense	probably benign	0.10
R7806:Fap	UTSW	2	62503414	missense	probably damaging	1.00
R8000:Fap	UTSW	2	62502798	critical splice donor site	probably null
R8115:Fap	UTSW	2	62519041	missense	probably benign	0.07
R8737:Fap	UTSW	2	62512433	missense	probably benign	0.00
R8899:Fap	UTSW	2	62518473	missense	probably damaging	1.00
R8924:Fap	UTSW	2	62547821	missense	probably benign
R8972:Fap	UTSW	2	62548583	missense	probably benign	0.02
R8998:Fap	UTSW	2	62537024	missense	probably benign	0.12
R8999:Fap	UTSW	2	62537024	missense	probably benign	0.12
R9418:Fap	UTSW	2	62554837	nonsense	probably null
R9521:Fap	UTSW	2	62542156	missense	probably benign
R9686:Fap	UTSW	2	62573513	missense	possibly damaging	0.86
X0017:Fap	UTSW	2	62556180	missense	probably benign	0.04
X0026:Fap	UTSW	2	62512390	missense	probably damaging	1.00
Z1176:Fap	UTSW	2	62528774	missense	possibly damaging	0.87
Z1177:Fap	UTSW	2	62502446	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGACTAAAGAACATGCAGTCTTC -3'
(R):5'- GCCAGGATGCCACTTCTTAC -3'

Sequencing Primer
(F):5'- GCAGTCTTCATGAAATCATAGCTG -3'
(R):5'- TCAAAGACACTGTGGTACGTTCC -3'

Posted On

2016-07-22