Incidental Mutation 'R5281:Olfr609'
ID402780
Institutional Source Beutler Lab
Gene Symbol Olfr609
Ensembl Gene ENSMUSG00000046396
Gene Nameolfactory receptor 609
SynonymsMOR9-1, GA_x6K02T2PBJ9-6207735-6206776
MMRRC Submission 042866-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R5281 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103490025-103498062 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103491973 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 302 (I302V)
Ref Sequence ENSEMBL: ENSMUSP00000149804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055787] [ENSMUST00000216075] [ENSMUST00000216360]
Predicted Effect probably benign
Transcript: ENSMUST00000055787
AA Change: I302V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000051749
Gene: ENSMUSG00000046396
AA Change: I302V

DomainStartEndE-ValueType
Pfam:7tm_4 30 308 1.4e-119 PFAM
Pfam:7TM_GPCR_Srsx 34 169 2.2e-10 PFAM
Pfam:7tm_1 40 291 3.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216075
AA Change: I302V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000216360
AA Change: I302V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 A G 7: 82,528,934 H535R probably damaging Het
Aff4 A G 11: 53,372,288 E45G probably damaging Het
Ano10 A G 9: 122,261,486 S254P probably damaging Het
Arhgap21 T A 2: 20,849,316 E1745V probably damaging Het
Atp10b T C 11: 43,254,336 L1302P probably damaging Het
Btn2a2 A G 13: 23,478,832 V316A probably damaging Het
C2cd4c G A 10: 79,613,044 P90S probably benign Het
Cant1 A T 11: 118,408,870 W255R probably damaging Het
Cenpe A C 3: 135,230,150 K449Q possibly damaging Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Dmbt1 T C 7: 131,082,619 V615A probably damaging Het
Dnajc5b T C 3: 19,610,560 V174A probably benign Het
Dst C A 1: 34,257,782 H5751N probably benign Het
Eif2d A G 1: 131,173,343 E562G probably damaging Het
Epha10 A T 4: 124,913,988 probably benign Het
Epha4 C T 1: 77,374,867 G917D probably benign Het
Fap C T 2: 62,532,961 probably null Het
Fsd2 T C 7: 81,552,985 E282G probably benign Het
Gls A T 1: 52,191,157 M136K probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gusb T C 5: 129,998,526 T313A probably benign Het
Ints7 T C 1: 191,615,771 Y752H possibly damaging Het
Krt17 G A 11: 100,260,701 Q89* probably null Het
Mfsd4b4 T C 10: 39,892,471 I209V probably benign Het
Nr0b2 A G 4: 133,556,024 I191V probably benign Het
Pcdhb21 T C 18: 37,513,935 M39T probably benign Het
Pds5b T G 5: 150,746,608 Y354D probably benign Het
She A G 3: 89,849,581 D314G probably benign Het
Shpk T C 11: 73,215,120 M266T probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slfn4 T G 11: 83,187,199 V271G probably damaging Het
Slitrk6 C T 14: 110,750,373 R634H probably damaging Het
Trrap T C 5: 144,813,503 F1555L probably benign Het
Vldlr A C 19: 27,244,231 E665D probably benign Het
Whrn T C 4: 63,418,427 T633A probably benign Het
Xylt2 A G 11: 94,668,790 V342A probably benign Het
Zfp800 A T 6: 28,243,166 V600E probably benign Het
Other mutations in Olfr609
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02213:Olfr609 APN 7 103492488 missense probably benign 0.05
IGL02309:Olfr609 APN 7 103491999 missense probably damaging 0.99
R0782:Olfr609 UTSW 7 103492515 missense probably damaging 0.99
R0988:Olfr609 UTSW 7 103492747 missense probably damaging 1.00
R4013:Olfr609 UTSW 7 103492633 missense probably benign
R4600:Olfr609 UTSW 7 103492581 missense probably damaging 0.99
R4735:Olfr609 UTSW 7 103492060 missense possibly damaging 0.61
R4941:Olfr609 UTSW 7 103492251 missense probably damaging 1.00
R5204:Olfr609 UTSW 7 103492540 missense probably damaging 1.00
R5941:Olfr609 UTSW 7 103492720 missense possibly damaging 0.95
R6319:Olfr609 UTSW 7 103492725 missense possibly damaging 0.84
R6505:Olfr609 UTSW 7 103492651 missense probably damaging 1.00
R7258:Olfr609 UTSW 7 103492589 missense probably damaging 1.00
X0065:Olfr609 UTSW 7 103491918 makesense probably null
Z1177:Olfr609 UTSW 7 103492610 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATGACCTGTGCTCACCTAG -3'
(R):5'- AAGCCCTCAACACCTGTGTC -3'

Sequencing Primer
(F):5'- TCTGTATATTTACATGCCTGCAAAC -3'
(R):5'- CAACACCTGTGTCTCCCAC -3'
Posted On2016-07-22