Mutagenetix > Incidental Mutations

Incidental Mutation 'R5281:Shpk'

402789

Institutional Source

Beutler Lab

Gene Symbol

Shpk

Ensembl Gene

ENSMUSG00000005951

Gene Name

sedoheptulokinase

Synonyms

4930431K22Rik, Carkl

MMRRC Submission

042866-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5281 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

73199460-73224511 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 73215120 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 266 (M266T)

Ref Sequence

ENSEMBL: ENSMUSP00000006105 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006105] [ENSMUST00000131927]

Predicted Effect

probably benign
Transcript: ENSMUST00000006105
AA Change: M266T

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000006105
Gene: ENSMUSG00000005951
AA Change: M266T

Domain	Start	End	E-Value	Type
Pfam:FGGY_N	6	264	3.4e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131927

SMART Domains

Protein: ENSMUSP00000123639
Gene: ENSMUSG00000005951

Domain	Start	End	E-Value	Type
Pfam:FGGY_N	6	109	3.7e-14	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has weak homology to several carbohydrate kinases, a class of proteins involved in the phosphorylation of sugars as they enter a cell, inhibiting return across the cell membrane. Sequence variation between this novel gene and known carbohydrate kinases suggests the possibility of a different substrate, cofactor or changes in kinetic properties distinguishing it from other carbohydrate kinases. The gene resides in a region commonly deleted in cystinosis patients, suggesting a role as a modifier for the cystinosis phenotype. The genomic region is also rich in Alu repetitive sequences, frequently involved in chromosomal rearrangements. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl3	A	G	7: 82,528,934	H535R	probably damaging	Het
Aff4	A	G	11: 53,372,288	E45G	probably damaging	Het
Ano10	A	G	9: 122,261,486	S254P	probably damaging	Het
Arhgap21	T	A	2: 20,849,316	E1745V	probably damaging	Het
Atp10b	T	C	11: 43,254,336	L1302P	probably damaging	Het
Btn2a2	A	G	13: 23,478,832	V316A	probably damaging	Het
C2cd4c	G	A	10: 79,613,044	P90S	probably benign	Het
Cant1	A	T	11: 118,408,870	W255R	probably damaging	Het
Cenpe	A	C	3: 135,230,150	K449Q	possibly damaging	Het
Col4a4	C	T	1: 82,493,591	G681E	unknown	Het
Dmbt1	T	C	7: 131,082,619	V615A	probably damaging	Het
Dnajc5b	T	C	3: 19,610,560	V174A	probably benign	Het
Dst	C	A	1: 34,257,782	H5751N	probably benign	Het
Eif2d	A	G	1: 131,173,343	E562G	probably damaging	Het
Epha10	A	T	4: 124,913,988		probably benign	Het
Epha4	C	T	1: 77,374,867	G917D	probably benign	Het
Fap	C	T	2: 62,532,961		probably null	Het
Fsd2	T	C	7: 81,552,985	E282G	probably benign	Het
Gls	A	T	1: 52,191,157	M136K	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gusb	T	C	5: 129,998,526	T313A	probably benign	Het
Ints7	T	C	1: 191,615,771	Y752H	possibly damaging	Het
Krt17	G	A	11: 100,260,701	Q89*	probably null	Het
Mfsd4b4	T	C	10: 39,892,471	I209V	probably benign	Het
Nr0b2	A	G	4: 133,556,024	I191V	probably benign	Het
Olfr609	T	C	7: 103,491,973	I302V	probably benign	Het
Pcdhb21	T	C	18: 37,513,935	M39T	probably benign	Het
Pds5b	T	G	5: 150,746,608	Y354D	probably benign	Het
She	A	G	3: 89,849,581	D314G	probably benign	Het
Skint8	C	A	4: 111,950,193	L359M	probably damaging	Het
Slfn4	T	G	11: 83,187,199	V271G	probably damaging	Het
Slitrk6	C	T	14: 110,750,373	R634H	probably damaging	Het
Trrap	T	C	5: 144,813,503	F1555L	probably benign	Het
Vldlr	A	C	19: 27,244,231	E665D	probably benign	Het
Whrn	T	C	4: 63,418,427	T633A	probably benign	Het
Xylt2	A	G	11: 94,668,790	V342A	probably benign	Het
Zfp800	A	T	6: 28,243,166	V600E	probably benign	Het

Other mutations in Shpk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02097:Shpk	APN	11	73203995	missense	probably damaging	1.00
IGL03411:Shpk	APN	11	73215035	missense	probably benign	0.25
R0125:Shpk	UTSW	11	73214222	splice site	probably benign
R0826:Shpk	UTSW	11	73204031	missense	probably damaging	1.00
R1055:Shpk	UTSW	11	73215119	missense	probably benign
R1670:Shpk	UTSW	11	73222931	missense	probably benign	0.00
R2077:Shpk	UTSW	11	73203959	missense	probably damaging	1.00
R2263:Shpk	UTSW	11	73206493	critical splice donor site	probably benign
R5443:Shpk	UTSW	11	73222781	missense	possibly damaging	0.94
R5461:Shpk	UTSW	11	73199535	missense	probably benign	0.08
R6063:Shpk	UTSW	11	73213444	nonsense	probably null
R6424:Shpk	UTSW	11	73213492	missense	possibly damaging	0.50
R7150:Shpk	UTSW	11	73213489	missense	probably damaging	0.99
R7176:Shpk	UTSW	11	73222988	missense	probably benign	0.05
R7255:Shpk	UTSW	11	73199660	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCTTTCCAGGAACCGGTAAAAGC -3'
(R):5'- AGTAAAGCCCAGGTGGTCAG -3'

Sequencing Primer
(F):5'- ACGCGAATGCTATTGCTCAC -3'
(R):5'- CAGGGATGAAGGTGTTTCCAC -3'

Posted On

2016-07-22