Incidental Mutation 'R5281:Shpk'
ID402789
Institutional Source Beutler Lab
Gene Symbol Shpk
Ensembl Gene ENSMUSG00000005951
Gene Namesedoheptulokinase
Synonyms4930431K22Rik, Carkl
MMRRC Submission 042866-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5281 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73199460-73224511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73215120 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 266 (M266T)
Ref Sequence ENSEMBL: ENSMUSP00000006105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006105] [ENSMUST00000131927]
Predicted Effect probably benign
Transcript: ENSMUST00000006105
AA Change: M266T

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000006105
Gene: ENSMUSG00000005951
AA Change: M266T

DomainStartEndE-ValueType
Pfam:FGGY_N 6 264 3.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131927
SMART Domains Protein: ENSMUSP00000123639
Gene: ENSMUSG00000005951

DomainStartEndE-ValueType
Pfam:FGGY_N 6 109 3.7e-14 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has weak homology to several carbohydrate kinases, a class of proteins involved in the phosphorylation of sugars as they enter a cell, inhibiting return across the cell membrane. Sequence variation between this novel gene and known carbohydrate kinases suggests the possibility of a different substrate, cofactor or changes in kinetic properties distinguishing it from other carbohydrate kinases. The gene resides in a region commonly deleted in cystinosis patients, suggesting a role as a modifier for the cystinosis phenotype. The genomic region is also rich in Alu repetitive sequences, frequently involved in chromosomal rearrangements. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 A G 7: 82,528,934 H535R probably damaging Het
Aff4 A G 11: 53,372,288 E45G probably damaging Het
Ano10 A G 9: 122,261,486 S254P probably damaging Het
Arhgap21 T A 2: 20,849,316 E1745V probably damaging Het
Atp10b T C 11: 43,254,336 L1302P probably damaging Het
Btn2a2 A G 13: 23,478,832 V316A probably damaging Het
C2cd4c G A 10: 79,613,044 P90S probably benign Het
Cant1 A T 11: 118,408,870 W255R probably damaging Het
Cenpe A C 3: 135,230,150 K449Q possibly damaging Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Dmbt1 T C 7: 131,082,619 V615A probably damaging Het
Dnajc5b T C 3: 19,610,560 V174A probably benign Het
Dst C A 1: 34,257,782 H5751N probably benign Het
Eif2d A G 1: 131,173,343 E562G probably damaging Het
Epha10 A T 4: 124,913,988 probably benign Het
Epha4 C T 1: 77,374,867 G917D probably benign Het
Fap C T 2: 62,532,961 probably null Het
Fsd2 T C 7: 81,552,985 E282G probably benign Het
Gls A T 1: 52,191,157 M136K probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gusb T C 5: 129,998,526 T313A probably benign Het
Ints7 T C 1: 191,615,771 Y752H possibly damaging Het
Krt17 G A 11: 100,260,701 Q89* probably null Het
Mfsd4b4 T C 10: 39,892,471 I209V probably benign Het
Nr0b2 A G 4: 133,556,024 I191V probably benign Het
Olfr609 T C 7: 103,491,973 I302V probably benign Het
Pcdhb21 T C 18: 37,513,935 M39T probably benign Het
Pds5b T G 5: 150,746,608 Y354D probably benign Het
She A G 3: 89,849,581 D314G probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slfn4 T G 11: 83,187,199 V271G probably damaging Het
Slitrk6 C T 14: 110,750,373 R634H probably damaging Het
Trrap T C 5: 144,813,503 F1555L probably benign Het
Vldlr A C 19: 27,244,231 E665D probably benign Het
Whrn T C 4: 63,418,427 T633A probably benign Het
Xylt2 A G 11: 94,668,790 V342A probably benign Het
Zfp800 A T 6: 28,243,166 V600E probably benign Het
Other mutations in Shpk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02097:Shpk APN 11 73203995 missense probably damaging 1.00
IGL03411:Shpk APN 11 73215035 missense probably benign 0.25
R0125:Shpk UTSW 11 73214222 splice site probably benign
R0826:Shpk UTSW 11 73204031 missense probably damaging 1.00
R1055:Shpk UTSW 11 73215119 missense probably benign
R1670:Shpk UTSW 11 73222931 missense probably benign 0.00
R2077:Shpk UTSW 11 73203959 missense probably damaging 1.00
R2263:Shpk UTSW 11 73206493 critical splice donor site probably benign
R5443:Shpk UTSW 11 73222781 missense possibly damaging 0.94
R5461:Shpk UTSW 11 73199535 missense probably benign 0.08
R6063:Shpk UTSW 11 73213444 nonsense probably null
R6424:Shpk UTSW 11 73213492 missense possibly damaging 0.50
R7150:Shpk UTSW 11 73213489 missense probably damaging 0.99
R7176:Shpk UTSW 11 73222988 missense probably benign 0.05
R7255:Shpk UTSW 11 73199660 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTTTCCAGGAACCGGTAAAAGC -3'
(R):5'- AGTAAAGCCCAGGTGGTCAG -3'

Sequencing Primer
(F):5'- ACGCGAATGCTATTGCTCAC -3'
(R):5'- CAGGGATGAAGGTGTTTCCAC -3'
Posted On2016-07-22