Incidental Mutation 'R5281:Gm11595'
ID402793
Institutional Source Beutler Lab
Gene Symbol Gm11595
Ensembl Gene ENSMUSG00000078668
Gene Namepredicted gene 11595
Synonyms
MMRRC Submission 042866-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5281 (G1)
Quality Score223
Status Not validated
Chromosome11
Chromosomal Location99771714-99772913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99772555 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 100 (R100C)
Ref Sequence ENSEMBL: ENSMUSP00000103064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107440]
Predicted Effect unknown
Transcript: ENSMUST00000107440
AA Change: R100C
SMART Domains Protein: ENSMUSP00000103064
Gene: ENSMUSG00000078668
AA Change: R100C

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 47 7.5e-9 PFAM
Pfam:Keratin_B2_2 14 58 2.8e-13 PFAM
Pfam:Keratin_B2_2 29 73 1.2e-13 PFAM
Pfam:Keratin_B2_2 72 112 2.3e-12 PFAM
Pfam:Keratin_B2_2 107 152 4.6e-14 PFAM
Pfam:Keratin_B2_2 118 162 1.1e-13 PFAM
Pfam:Keratin_B2_2 143 187 3.5e-10 PFAM
Pfam:Keratin_B2_2 168 212 5.6e-13 PFAM
Pfam:Keratin_B2_2 178 222 2.4e-12 PFAM
Pfam:Keratin_B2_2 208 257 1.6e-11 PFAM
Pfam:Keratin_B2_2 223 267 4e-14 PFAM
Pfam:Keratin_B2_2 248 289 9e-9 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 A G 7: 82,528,934 H535R probably damaging Het
Aff4 A G 11: 53,372,288 E45G probably damaging Het
Ano10 A G 9: 122,261,486 S254P probably damaging Het
Arhgap21 T A 2: 20,849,316 E1745V probably damaging Het
Atp10b T C 11: 43,254,336 L1302P probably damaging Het
Btn2a2 A G 13: 23,478,832 V316A probably damaging Het
C2cd4c G A 10: 79,613,044 P90S probably benign Het
Cant1 A T 11: 118,408,870 W255R probably damaging Het
Cenpe A C 3: 135,230,150 K449Q possibly damaging Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Dmbt1 T C 7: 131,082,619 V615A probably damaging Het
Dnajc5b T C 3: 19,610,560 V174A probably benign Het
Dst C A 1: 34,257,782 H5751N probably benign Het
Eif2d A G 1: 131,173,343 E562G probably damaging Het
Epha10 A T 4: 124,913,988 probably benign Het
Epha4 C T 1: 77,374,867 G917D probably benign Het
Fap C T 2: 62,532,961 probably null Het
Fsd2 T C 7: 81,552,985 E282G probably benign Het
Gls A T 1: 52,191,157 M136K probably damaging Het
Gusb T C 5: 129,998,526 T313A probably benign Het
Ints7 T C 1: 191,615,771 Y752H possibly damaging Het
Krt17 G A 11: 100,260,701 Q89* probably null Het
Mfsd4b4 T C 10: 39,892,471 I209V probably benign Het
Nr0b2 A G 4: 133,556,024 I191V probably benign Het
Olfr609 T C 7: 103,491,973 I302V probably benign Het
Pcdhb21 T C 18: 37,513,935 M39T probably benign Het
Pds5b T G 5: 150,746,608 Y354D probably benign Het
She A G 3: 89,849,581 D314G probably benign Het
Shpk T C 11: 73,215,120 M266T probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slfn4 T G 11: 83,187,199 V271G probably damaging Het
Slitrk6 C T 14: 110,750,373 R634H probably damaging Het
Trrap T C 5: 144,813,503 F1555L probably benign Het
Vldlr A C 19: 27,244,231 E665D probably benign Het
Whrn T C 4: 63,418,427 T633A probably benign Het
Xylt2 A G 11: 94,668,790 V342A probably benign Het
Zfp800 A T 6: 28,243,166 V600E probably benign Het
Other mutations in Gm11595
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Gm11595 APN 11 99772042 missense unknown
IGL00987:Gm11595 APN 11 99772539 missense unknown
IGL01662:Gm11595 APN 11 99772672 missense unknown
IGL01994:Gm11595 APN 11 99772201 missense unknown
R0548:Gm11595 UTSW 11 99772141 missense unknown
R1923:Gm11595 UTSW 11 99772539 missense unknown
R2127:Gm11595 UTSW 11 99772501 missense unknown
R2128:Gm11595 UTSW 11 99772501 missense unknown
R3807:Gm11595 UTSW 11 99772554 missense unknown
R4007:Gm11595 UTSW 11 99772035 missense unknown
R5283:Gm11595 UTSW 11 99772555 missense unknown
R5303:Gm11595 UTSW 11 99772555 missense unknown
R5305:Gm11595 UTSW 11 99772555 missense unknown
R5306:Gm11595 UTSW 11 99772555 missense unknown
R5307:Gm11595 UTSW 11 99772555 missense unknown
R5308:Gm11595 UTSW 11 99772555 missense unknown
R5561:Gm11595 UTSW 11 99772555 missense unknown
R5637:Gm11595 UTSW 11 99772555 missense unknown
R5639:Gm11595 UTSW 11 99772555 missense unknown
R5718:Gm11595 UTSW 11 99772555 missense unknown
R5719:Gm11595 UTSW 11 99772555 missense unknown
R5720:Gm11595 UTSW 11 99772555 missense unknown
R5721:Gm11595 UTSW 11 99772555 missense unknown
R5769:Gm11595 UTSW 11 99772555 missense unknown
R5770:Gm11595 UTSW 11 99772555 missense unknown
R5771:Gm11595 UTSW 11 99772555 missense unknown
R5791:Gm11595 UTSW 11 99772555 missense unknown
R5841:Gm11595 UTSW 11 99772317 missense unknown
R6054:Gm11595 UTSW 11 99772648 missense unknown
R6277:Gm11595 UTSW 11 99772684 missense unknown
R6281:Gm11595 UTSW 11 99772555 missense unknown
R6282:Gm11595 UTSW 11 99772555 missense unknown
R6310:Gm11595 UTSW 11 99772555 missense unknown
R6321:Gm11595 UTSW 11 99772555 missense unknown
R6322:Gm11595 UTSW 11 99772555 missense unknown
R6327:Gm11595 UTSW 11 99772555 missense unknown
R6337:Gm11595 UTSW 11 99772555 missense unknown
R6368:Gm11595 UTSW 11 99772555 missense unknown
R6369:Gm11595 UTSW 11 99772555 missense unknown
R6431:Gm11595 UTSW 11 99772774 missense unknown
R6483:Gm11595 UTSW 11 99772555 missense unknown
R6485:Gm11595 UTSW 11 99772555 missense unknown
R6493:Gm11595 UTSW 11 99772555 missense unknown
R6758:Gm11595 UTSW 11 99772540 missense unknown
R6758:Gm11595 UTSW 11 99772541 nonsense probably null
R7037:Gm11595 UTSW 11 99772648 missense unknown
R8053:Gm11595 UTSW 11 99772128 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGAACTACCACAGCAGGGG -3'
(R):5'- ACCATGGTCAGTTCCTGTTG -3'

Sequencing Primer
(F):5'- CGACAGCAGCTGGAGATG -3'
(R):5'- TGCCAGACCACCTGCTGTAG -3'
Posted On2016-07-22