Incidental Mutation 'R5281:Krt17'
ID402794
Institutional Source Beutler Lab
Gene Symbol Krt17
Ensembl Gene ENSMUSG00000035557
Gene Namekeratin 17
SynonymsKrt1-17, K17
MMRRC Submission 042866-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5281 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100256217-100261029 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 100260701 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 89 (Q89*)
Ref Sequence ENSEMBL: ENSMUSP00000079699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017270] [ENSMUST00000080893]
Predicted Effect probably benign
Transcript: ENSMUST00000017270
SMART Domains Protein: ENSMUSP00000017270
Gene: ENSMUSG00000053654

DomainStartEndE-ValueType
low complexity region 62 84 N/A INTRINSIC
Filament 93 404 5.58e-184 SMART
Predicted Effect probably null
Transcript: ENSMUST00000080893
AA Change: Q89*
SMART Domains Protein: ENSMUSP00000079699
Gene: ENSMUSG00000035557
AA Change: Q89*

DomainStartEndE-ValueType
Filament 83 394 9.36e-177 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107406
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the type I keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. The encoded protein is a cytokeratin required for the normal growth of hair follicles and may act in psoriasis as an immunopathogenic autoantigen. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display age- and strain-dependent alopecia associated with frequent absence of vibrissae, increased hair fragility, abnormal hair cycling, altered hair follicle morphology, and apoptosis in matrix cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 A G 7: 82,528,934 H535R probably damaging Het
Aff4 A G 11: 53,372,288 E45G probably damaging Het
Ano10 A G 9: 122,261,486 S254P probably damaging Het
Arhgap21 T A 2: 20,849,316 E1745V probably damaging Het
Atp10b T C 11: 43,254,336 L1302P probably damaging Het
Btn2a2 A G 13: 23,478,832 V316A probably damaging Het
C2cd4c G A 10: 79,613,044 P90S probably benign Het
Cant1 A T 11: 118,408,870 W255R probably damaging Het
Cenpe A C 3: 135,230,150 K449Q possibly damaging Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Dmbt1 T C 7: 131,082,619 V615A probably damaging Het
Dnajc5b T C 3: 19,610,560 V174A probably benign Het
Dst C A 1: 34,257,782 H5751N probably benign Het
Eif2d A G 1: 131,173,343 E562G probably damaging Het
Epha10 A T 4: 124,913,988 probably benign Het
Epha4 C T 1: 77,374,867 G917D probably benign Het
Fap C T 2: 62,532,961 probably null Het
Fsd2 T C 7: 81,552,985 E282G probably benign Het
Gls A T 1: 52,191,157 M136K probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gusb T C 5: 129,998,526 T313A probably benign Het
Ints7 T C 1: 191,615,771 Y752H possibly damaging Het
Mfsd4b4 T C 10: 39,892,471 I209V probably benign Het
Nr0b2 A G 4: 133,556,024 I191V probably benign Het
Olfr609 T C 7: 103,491,973 I302V probably benign Het
Pcdhb21 T C 18: 37,513,935 M39T probably benign Het
Pds5b T G 5: 150,746,608 Y354D probably benign Het
She A G 3: 89,849,581 D314G probably benign Het
Shpk T C 11: 73,215,120 M266T probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slfn4 T G 11: 83,187,199 V271G probably damaging Het
Slitrk6 C T 14: 110,750,373 R634H probably damaging Het
Trrap T C 5: 144,813,503 F1555L probably benign Het
Vldlr A C 19: 27,244,231 E665D probably benign Het
Whrn T C 4: 63,418,427 T633A probably benign Het
Xylt2 A G 11: 94,668,790 V342A probably benign Het
Zfp800 A T 6: 28,243,166 V600E probably benign Het
Other mutations in Krt17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Krt17 APN 11 100260631 missense probably damaging 1.00
IGL02291:Krt17 APN 11 100256493 missense probably benign 0.42
IGL03392:Krt17 APN 11 100259735 missense possibly damaging 0.73
R0189:Krt17 UTSW 11 100260619 missense possibly damaging 0.95
R0238:Krt17 UTSW 11 100260878 nonsense probably null
R0238:Krt17 UTSW 11 100260878 nonsense probably null
R0239:Krt17 UTSW 11 100260878 nonsense probably null
R0239:Krt17 UTSW 11 100260878 nonsense probably null
R1448:Krt17 UTSW 11 100257539 missense possibly damaging 0.69
R1510:Krt17 UTSW 11 100257539 missense possibly damaging 0.69
R4029:Krt17 UTSW 11 100257523 missense probably damaging 1.00
R4235:Krt17 UTSW 11 100257868 missense possibly damaging 0.90
R4888:Krt17 UTSW 11 100256479 missense probably benign 0.06
R7213:Krt17 UTSW 11 100258530 missense probably benign 0.09
R7238:Krt17 UTSW 11 100257787 missense probably benign 0.19
R7304:Krt17 UTSW 11 100257337 missense probably benign
R7438:Krt17 UTSW 11 100258465 missense probably damaging 1.00
R7796:Krt17 UTSW 11 100260872 missense probably benign 0.23
Z1176:Krt17 UTSW 11 100260923 missense probably benign 0.23
Z1177:Krt17 UTSW 11 100259196 missense probably damaging 1.00
Z1177:Krt17 UTSW 11 100259711 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GTTGACTCCAGGCCTTGATG -3'
(R):5'- TCTATCAAGGGCTCCTCTGG -3'

Sequencing Primer
(F):5'- GGGTGGTTTATGCCCCTCC -3'
(R):5'- TGGAGGTTCATCTCGGACCTC -3'
Posted On2016-07-22