Mutagenetix > Incidental Mutation

Incidental Mutation 'R5281:Slitrk6'

402797

Institutional Source

Beutler Lab

Gene Symbol

Slitrk6

Ensembl Gene

ENSMUSG00000045871

Gene Name

SLIT and NTRK-like family, member 6

Synonyms

4832410J21Rik

MMRRC Submission

042866-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.167) question?

Stock #

R5281 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110748580-110755149 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 110750373 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 634 (R634H)

Ref Sequence

ENSEMBL: ENSMUSP00000077492 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078386]

AlphaFold

Q8C110

Predicted Effect

probably damaging
Transcript: ENSMUST00000078386
AA Change: R634H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077492
Gene: ENSMUSG00000045871
AA Change: R634H

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:LRRNT	30	68	4e-15	BLAST
LRR	87	110	1.71e1	SMART
LRR	111	134	3.07e-1	SMART
LRR	135	158	4.44e0	SMART
LRR_TYP	159	182	2.09e-3	SMART
LRR	185	206	6.23e1	SMART
LRRCT	218	268	5.61e-5	SMART
low complexity region	287	301	N/A	INTRINSIC
Blast:LRRNT	327	364	2e-17	BLAST
LRR	388	408	2.68e1	SMART
LRR_TYP	409	432	3.63e-3	SMART
LRR_TYP	433	456	6.23e-2	SMART
LRR_TYP	457	480	3.69e-4	SMART
low complexity region	501	513	N/A	INTRINSIC
LRRCT	516	566	1.53e-6	SMART
transmembrane domain	610	632	N/A	INTRINSIC
low complexity region	634	642	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLITRK protein family. Members of this family are integral membrane proteins that are characterized by two N-terminal leucine-rich repeat (LRR) domains and a C-terminal region that shares homology with trk neurotrophin receptors. This protein functions as a regulator of neurite outgrowth required for normal hearing and vision. Mutations in this gene are a cause of myopia and deafness. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous deficient mice show pronounced reduction in cochlear innervation. Innervation to the posterior crista is variably impaired and a there is a loss of neurons in the spiral and vestibular ganglia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl3	A	G	7: 82,528,934	H535R	probably damaging	Het
Aff4	A	G	11: 53,372,288	E45G	probably damaging	Het
Ano10	A	G	9: 122,261,486	S254P	probably damaging	Het
Arhgap21	T	A	2: 20,849,316	E1745V	probably damaging	Het
Atp10b	T	C	11: 43,254,336	L1302P	probably damaging	Het
Btn2a2	A	G	13: 23,478,832	V316A	probably damaging	Het
C2cd4c	G	A	10: 79,613,044	P90S	probably benign	Het
Cant1	A	T	11: 118,408,870	W255R	probably damaging	Het
Cenpe	A	C	3: 135,230,150	K449Q	possibly damaging	Het
Col4a4	C	T	1: 82,493,591	G681E	unknown	Het
Dmbt1	T	C	7: 131,082,619	V615A	probably damaging	Het
Dnajc5b	T	C	3: 19,610,560	V174A	probably benign	Het
Dst	C	A	1: 34,257,782	H5751N	probably benign	Het
Eif2d	A	G	1: 131,173,343	E562G	probably damaging	Het
Epha10	A	T	4: 124,913,988		probably benign	Het
Epha4	C	T	1: 77,374,867	G917D	probably benign	Het
Fap	C	T	2: 62,532,961		probably null	Het
Fsd2	T	C	7: 81,552,985	E282G	probably benign	Het
Gls	A	T	1: 52,191,157	M136K	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gusb	T	C	5: 129,998,526	T313A	probably benign	Het
Ints7	T	C	1: 191,615,771	Y752H	possibly damaging	Het
Krt17	G	A	11: 100,260,701	Q89*	probably null	Het
Mfsd4b4	T	C	10: 39,892,471	I209V	probably benign	Het
Nr0b2	A	G	4: 133,556,024	I191V	probably benign	Het
Olfr609	T	C	7: 103,491,973	I302V	probably benign	Het
Pcdhb21	T	C	18: 37,513,935	M39T	probably benign	Het
Pds5b	T	G	5: 150,746,608	Y354D	probably benign	Het
She	A	G	3: 89,849,581	D314G	probably benign	Het
Shpk	T	C	11: 73,215,120	M266T	probably benign	Het
Skint8	C	A	4: 111,950,193	L359M	probably damaging	Het
Slfn4	T	G	11: 83,187,199	V271G	probably damaging	Het
Trrap	T	C	5: 144,813,503	F1555L	probably benign	Het
Vldlr	A	C	19: 27,244,231	E665D	probably benign	Het
Whrn	T	C	4: 63,418,427	T633A	probably benign	Het
Xylt2	A	G	11: 94,668,790	V342A	probably benign	Het
Zfp800	A	T	6: 28,243,166	V600E	probably benign	Het

Other mutations in Slitrk6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00517:Slitrk6	APN	14	110751115	missense	probably benign	0.35
IGL01131:Slitrk6	APN	14	110751576	missense	probably damaging	1.00
IGL01294:Slitrk6	APN	14	110750074	missense	probably benign
IGL01295:Slitrk6	APN	14	110751436	missense	possibly damaging	0.50
IGL01762:Slitrk6	APN	14	110751624	missense	probably damaging	1.00
IGL02165:Slitrk6	APN	14	110751817	missense	probably benign	0.41
IGL02546:Slitrk6	APN	14	110749794	missense	probably benign	0.18
IGL03103:Slitrk6	APN	14	110749941	missense	probably benign
PIT1430001:Slitrk6	UTSW	14	110750427	missense	possibly damaging	0.93
PIT4480001:Slitrk6	UTSW	14	110749825	frame shift	probably null
R0035:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0066:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0067:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0069:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0107:Slitrk6	UTSW	14	110751963	missense	possibly damaging	0.69
R0157:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0422:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0422:Slitrk6	UTSW	14	110752293	start gained	probably benign
R0454:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0505:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0633:Slitrk6	UTSW	14	110751885	missense	probably damaging	1.00
R0711:Slitrk6	UTSW	14	110749819	missense	probably damaging	1.00
R0843:Slitrk6	UTSW	14	110750098	missense	probably benign
R1298:Slitrk6	UTSW	14	110751865	missense	possibly damaging	0.94
R1693:Slitrk6	UTSW	14	110750928	missense	probably damaging	1.00
R1756:Slitrk6	UTSW	14	110750552	missense	probably benign
R1998:Slitrk6	UTSW	14	110751823	missense	probably damaging	0.99
R2049:Slitrk6	UTSW	14	110750794	missense	probably benign	0.00
R2140:Slitrk6	UTSW	14	110750794	missense	probably benign	0.00
R2142:Slitrk6	UTSW	14	110750794	missense	probably benign	0.00
R2314:Slitrk6	UTSW	14	110751955	missense	probably damaging	1.00
R2566:Slitrk6	UTSW	14	110750272	missense	probably benign	0.00
R4231:Slitrk6	UTSW	14	110751388	missense	probably benign	0.02
R4236:Slitrk6	UTSW	14	110750148	missense	probably benign	0.07
R4247:Slitrk6	UTSW	14	110750739	missense	probably damaging	1.00
R4576:Slitrk6	UTSW	14	110750170	missense	probably benign	0.05
R4856:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4858:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4859:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4860:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4860:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4886:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4931:Slitrk6	UTSW	14	110750379	missense	probably damaging	1.00
R5255:Slitrk6	UTSW	14	110749753	makesense	probably null
R5450:Slitrk6	UTSW	14	110750097	missense	probably benign
R5579:Slitrk6	UTSW	14	110751217	missense	possibly damaging	0.82
R5689:Slitrk6	UTSW	14	110752126	missense	probably benign
R5935:Slitrk6	UTSW	14	110749873	missense	probably benign	0.00
R6016:Slitrk6	UTSW	14	110750526	missense	probably benign	0.00
R6312:Slitrk6	UTSW	14	110750247	missense	probably benign	0.00
R6890:Slitrk6	UTSW	14	110751096	nonsense	probably null
R6952:Slitrk6	UTSW	14	110750542	missense	probably benign
R7378:Slitrk6	UTSW	14	110749863	missense	probably damaging	1.00
R8354:Slitrk6	UTSW	14	110752046	missense	probably damaging	1.00
R8401:Slitrk6	UTSW	14	110752021	missense	possibly damaging	0.67
R8454:Slitrk6	UTSW	14	110752046	missense	probably damaging	1.00
R8807:Slitrk6	UTSW	14	110750691	missense	possibly damaging	0.77
R8814:Slitrk6	UTSW	14	110749938	missense	probably benign
R8826:Slitrk6	UTSW	14	110751369	missense	probably benign
R9681:Slitrk6	UTSW	14	110750826	missense	probably damaging	1.00
R9740:Slitrk6	UTSW	14	110749998	missense	probably damaging	0.99
R9740:Slitrk6	UTSW	14	110750012	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- TCTGTAGACATGAACCATTGGG -3'
(R):5'- AAGCCCTCAACAGTGATCTTC -3'

Sequencing Primer
(F):5'- GTAGACATGAACCATTGGGCTCAC -3'
(R):5'- TGCCCTGGTTTAGTGAATAATCC -3'

Posted On

2016-07-22