Incidental Mutation 'R5281:Pcdhb21'
ID402798
Institutional Source Beutler Lab
Gene Symbol Pcdhb21
Ensembl Gene ENSMUSG00000044022
Gene Nameprotocadherin beta 21
SynonymsPcdhb18, PcdhbU
MMRRC Submission 042866-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5281 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37513621-37518325 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37513935 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 39 (M39T)
Ref Sequence ENSEMBL: ENSMUSP00000056424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061405] [ENSMUST00000097609] [ENSMUST00000115661] [ENSMUST00000192409] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000061405
AA Change: M39T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000056424
Gene: ENSMUSG00000044022
AA Change: M39T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Cadherin_2 30 110 4.2e-30 PFAM
CA 153 238 1.8e-17 SMART
CA 262 343 1.54e-25 SMART
CA 367 448 1.03e-21 SMART
CA 472 558 3.41e-27 SMART
CA 588 669 1.54e-11 SMART
Pfam:Cadherin_C_2 686 769 1.5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097609
SMART Domains Protein: ENSMUSP00000095214
Gene: ENSMUSG00000073591

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cadherin_2 28 110 5.8e-32 PFAM
CA 153 238 3.99e-19 SMART
CA 262 343 2.18e-25 SMART
CA 366 447 1.53e-20 SMART
CA 471 557 3.6e-26 SMART
CA 587 668 5.35e-11 SMART
Pfam:Cadherin_C_2 685 768 4.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192409
SMART Domains Protein: ENSMUSP00000141521
Gene: ENSMUSG00000073591

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cadherin_2 27 110 2.5e-32 PFAM
CA 153 238 3.99e-19 SMART
CA 262 343 2.18e-25 SMART
CA 366 447 1.53e-20 SMART
CA 471 557 3.6e-26 SMART
CA 587 668 5.35e-11 SMART
transmembrane domain 689 711 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 A G 7: 82,528,934 H535R probably damaging Het
Aff4 A G 11: 53,372,288 E45G probably damaging Het
Ano10 A G 9: 122,261,486 S254P probably damaging Het
Arhgap21 T A 2: 20,849,316 E1745V probably damaging Het
Atp10b T C 11: 43,254,336 L1302P probably damaging Het
Btn2a2 A G 13: 23,478,832 V316A probably damaging Het
C2cd4c G A 10: 79,613,044 P90S probably benign Het
Cant1 A T 11: 118,408,870 W255R probably damaging Het
Cenpe A C 3: 135,230,150 K449Q possibly damaging Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Dmbt1 T C 7: 131,082,619 V615A probably damaging Het
Dnajc5b T C 3: 19,610,560 V174A probably benign Het
Dst C A 1: 34,257,782 H5751N probably benign Het
Eif2d A G 1: 131,173,343 E562G probably damaging Het
Epha10 A T 4: 124,913,988 probably benign Het
Epha4 C T 1: 77,374,867 G917D probably benign Het
Fap C T 2: 62,532,961 probably null Het
Fsd2 T C 7: 81,552,985 E282G probably benign Het
Gls A T 1: 52,191,157 M136K probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gusb T C 5: 129,998,526 T313A probably benign Het
Ints7 T C 1: 191,615,771 Y752H possibly damaging Het
Krt17 G A 11: 100,260,701 Q89* probably null Het
Mfsd4b4 T C 10: 39,892,471 I209V probably benign Het
Nr0b2 A G 4: 133,556,024 I191V probably benign Het
Olfr609 T C 7: 103,491,973 I302V probably benign Het
Pds5b T G 5: 150,746,608 Y354D probably benign Het
She A G 3: 89,849,581 D314G probably benign Het
Shpk T C 11: 73,215,120 M266T probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slfn4 T G 11: 83,187,199 V271G probably damaging Het
Slitrk6 C T 14: 110,750,373 R634H probably damaging Het
Trrap T C 5: 144,813,503 F1555L probably benign Het
Vldlr A C 19: 27,244,231 E665D probably benign Het
Whrn T C 4: 63,418,427 T633A probably benign Het
Xylt2 A G 11: 94,668,790 V342A probably benign Het
Zfp800 A T 6: 28,243,166 V600E probably benign Het
Other mutations in Pcdhb21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Pcdhb21 APN 18 37514553 missense probably damaging 1.00
IGL01860:Pcdhb21 APN 18 37514905 missense probably benign 0.00
IGL02139:Pcdhb21 APN 18 37515246 missense probably damaging 1.00
IGL02370:Pcdhb21 APN 18 37514592 unclassified probably null
IGL03108:Pcdhb21 APN 18 37515891 unclassified probably null
IGL03265:Pcdhb21 APN 18 37515153 missense probably damaging 1.00
R0454:Pcdhb21 UTSW 18 37514513 missense probably damaging 1.00
R0519:Pcdhb21 UTSW 18 37516032 missense possibly damaging 0.95
R0647:Pcdhb21 UTSW 18 37513860 missense probably damaging 0.99
R0689:Pcdhb21 UTSW 18 37515317 missense probably benign 0.00
R1607:Pcdhb21 UTSW 18 37515479 missense probably damaging 1.00
R1649:Pcdhb21 UTSW 18 37515613 missense probably damaging 1.00
R1777:Pcdhb21 UTSW 18 37515718 missense possibly damaging 0.80
R1865:Pcdhb21 UTSW 18 37514595 missense possibly damaging 0.95
R4595:Pcdhb21 UTSW 18 37514515 missense probably damaging 1.00
R4888:Pcdhb21 UTSW 18 37515077 missense possibly damaging 0.76
R5396:Pcdhb21 UTSW 18 37515719 missense probably benign 0.03
R5398:Pcdhb21 UTSW 18 37515719 missense probably benign 0.03
R5399:Pcdhb21 UTSW 18 37515719 missense probably benign 0.03
R5635:Pcdhb21 UTSW 18 37513917 missense probably benign 0.33
R6134:Pcdhb21 UTSW 18 37514408 missense probably benign 0.03
R6387:Pcdhb21 UTSW 18 37515332 missense probably benign 0.35
R6595:Pcdhb21 UTSW 18 37515908 missense probably damaging 1.00
R6750:Pcdhb21 UTSW 18 37514448 missense probably damaging 1.00
R6754:Pcdhb21 UTSW 18 37514683 missense probably benign 0.28
R6928:Pcdhb21 UTSW 18 37514421 missense probably damaging 1.00
R7420:Pcdhb21 UTSW 18 37515203 missense probably damaging 1.00
R7503:Pcdhb21 UTSW 18 37514975 missense probably benign 0.07
Z1088:Pcdhb21 UTSW 18 37514541 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATTCCCAAAGGTCCAGATGAGC -3'
(R):5'- ATGCAATATACAGGGTTCGCTG -3'

Sequencing Primer
(F):5'- ATGAGCGGAACCACTCTCTGAG -3'
(R):5'- TATACAGGGTTCGCTGCTAGAAC -3'
Posted On2016-07-22