Mutagenetix > Incidental Mutations

Incidental Mutation 'R0415:Ubr5'

40280

Institutional Source

Beutler Lab

Gene Symbol

Ubr5

Ensembl Gene

ENSMUSG00000037487

Gene Name

ubiquitin protein ligase E3 component n-recognin 5

Synonyms

Edd, 4432411E13Rik, Edd1

MMRRC Submission

038617-MU

Accession Numbers

NCBI RefSeq: NM_001081359.2, NM_001112721.1; MGI:1918040

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0415 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37967328-38078854 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 37972980 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 2626 (T2626A)

Ref Sequence

ENSEMBL: ENSMUSP00000154293 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110336] [ENSMUST00000226414] [ENSMUST00000228333]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000110336
AA Change: T2620A

PolyPhen 2 Score 0.330 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487
AA Change: T2620A

Domain	Start	End	E-Value	Type
low complexity region	94	111	N/A	INTRINSIC
low complexity region	129	156	N/A	INTRINSIC
Pfam:E3_UbLigase_EDD	179	230	9.7e-35	PFAM
low complexity region	282	323	N/A	INTRINSIC
low complexity region	614	628	N/A	INTRINSIC
low complexity region	860	870	N/A	INTRINSIC
low complexity region	933	950	N/A	INTRINSIC
low complexity region	970	999	N/A	INTRINSIC
low complexity region	1140	1151	N/A	INTRINSIC
ZnF_UBR1	1177	1244	5.42e-27	SMART
low complexity region	1396	1405	N/A	INTRINSIC
low complexity region	1524	1537	N/A	INTRINSIC
low complexity region	1567	1613	N/A	INTRINSIC
low complexity region	1641	1657	N/A	INTRINSIC
low complexity region	1662	1687	N/A	INTRINSIC
low complexity region	1726	1742	N/A	INTRINSIC
low complexity region	1759	1789	N/A	INTRINSIC
low complexity region	1879	1890	N/A	INTRINSIC
low complexity region	1972	1983	N/A	INTRINSIC
low complexity region	1986	1997	N/A	INTRINSIC
Blast:HECTc	2271	2313	2e-6	BLAST
low complexity region	2329	2366	N/A	INTRINSIC
PolyA	2389	2452	3.97e-33	SMART
HECTc	2432	2798	1e-151	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226369

Predicted Effect

probably damaging
Transcript: ENSMUST00000226414
AA Change: T2626A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226629

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228029

Predicted Effect

probably benign
Transcript: ENSMUST00000228333

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228368

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228804

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.6%

Validation Efficiency

97% (99/102)

MGI Phenotype

Strain: 3052764
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, impaired growth of the allantois, failure or impairment of chorioallantoic fusion, impaired angiogenesis in the yolk sac and allantois, decreased cell proliferation, and increased apoptosis. [provided by MGI curators]

Allele List at MGI

All alleles(151) : Targeted(3) Gene trapped(148)

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427G23Rik	A	T	5: 23,831,050		noncoding transcript	Het
Acox2	A	G	14: 8,243,835		probably benign	Het
Adgb	T	C	10: 10,431,067		probably null	Het
Adgra3	C	A	5: 49,961,757		probably benign	Het
Adgre4	G	A	17: 55,852,288	V658I	probably benign	Het
Ahnak	A	G	19: 9,012,871		probably benign	Het
Anapc2	A	G	2: 25,278,325	T159A	probably damaging	Het
Arfgef3	A	G	10: 18,613,127		probably benign	Het
Atf7ip	C	T	6: 136,560,012	S81L	possibly damaging	Het
Cacna1i	A	G	15: 80,368,830		probably benign	Het
Camk1	A	T	6: 113,341,891	Y20*	probably null	Het
Ccdc40	T	C	11: 119,232,118	Y249H	possibly damaging	Het
Cd109	T	A	9: 78,712,615	S1380T	probably benign	Het
Cfap57	A	T	4: 118,569,431	L1107Q	possibly damaging	Het
Col6a4	C	T	9: 106,075,080	V540I	probably damaging	Het
Cst9	T	A	2: 148,838,442		probably benign	Het
Cul5	C	T	9: 53,667,070	V73I	probably benign	Het
Cxcl16	T	A	11: 70,458,748	K84*	probably null	Het
Cyp2c29	T	C	19: 39,329,095		probably benign	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Dip2c	C	T	13: 9,568,289		probably benign	Het
Dis3	A	T	14: 99,087,456	I513N	probably damaging	Het
Dnajc16	A	T	4: 141,789,048	L3*	probably null	Het
Dopey1	T	A	9: 86,506,502	L480M	probably damaging	Het
Eml6	A	G	11: 29,749,392	V1787A	possibly damaging	Het
Etnk1	A	G	6: 143,180,774	N115S	probably damaging	Het
Fryl	T	C	5: 73,098,414	Y758C	probably damaging	Het
Gbp4	G	A	5: 105,121,106	R394C	possibly damaging	Het
Ggnbp2	A	C	11: 84,833,225		probably benign	Het
Gm7137	A	G	10: 77,788,173		probably benign	Het
Gstm2	T	A	3: 107,984,006	Q132L	probably benign	Het
Habp2	T	C	19: 56,317,717		probably benign	Het
Hectd2	T	C	19: 36,584,884		probably benign	Het
Htr6	A	G	4: 139,062,081	I291T	possibly damaging	Het
Ighg2c	T	C	12: 113,287,910	D199G	unknown	Het
Itih2	A	G	2: 10,105,615		probably benign	Het
Kcnab2	A	G	4: 152,395,136	F248S	probably benign	Het
Kcnc4	T	C	3: 107,445,433	K610E	probably damaging	Het
Kcnk16	T	A	14: 20,262,975		probably null	Het
Kndc1	C	T	7: 139,930,124	T1293I	probably damaging	Het
Lcp1	A	T	14: 75,227,006	I556F	possibly damaging	Het
Lrrc8d	T	C	5: 105,811,865	L47P	probably damaging	Het
Lyst	T	C	13: 13,711,610		probably benign	Het
Macrod2	G	A	2: 142,210,145		probably null	Het
Micalcl	C	T	7: 112,381,028	R70C	probably damaging	Het
Mllt3	ACTGCTGCTGCTGCTGCTGCT	ACTGCTGCTGCTGCTGCT	4: 87,841,339		probably benign	Het
Msh3	A	G	13: 92,346,786	V283A	possibly damaging	Het
Nup205	T	C	6: 35,214,634		probably benign	Het
Nxpe2	T	C	9: 48,326,614	T114A	probably damaging	Het
Olfr1023	A	T	2: 85,887,438	I213F	possibly damaging	Het
Olfr1034	A	T	2: 86,047,055	H191L	probably benign	Het
Olfr229	A	G	9: 39,909,983	Y60C	probably damaging	Het
Olfr78	C	T	7: 102,742,087	M305I	probably benign	Het
Olfr893	A	T	9: 38,209,973	M305L	probably benign	Het
Pard3	G	A	8: 127,610,566	G1221D	probably damaging	Het
Pax5	G	A	4: 44,691,886	A120V	probably damaging	Het
Pcsk6	C	T	7: 66,033,874	R746C	probably damaging	Het
Pif1	G	A	9: 65,588,051	C81Y	probably benign	Het
Plcb1	A	G	2: 135,337,499	Y609C	probably damaging	Het
Plcd4	C	A	1: 74,552,097	S217Y	probably damaging	Het
Plxna1	G	A	6: 89,357,336	H104Y	probably benign	Het
Polr2k	A	G	15: 36,175,456	Y45C	probably damaging	Het
Pqlc3	C	A	12: 16,997,710		probably benign	Het
Prex1	A	G	2: 166,586,699		probably benign	Het
Pth2r	A	G	1: 65,388,439	M424V	probably benign	Het
Pygm	A	G	19: 6,391,366	R464G	probably benign	Het
Rad51c	A	G	11: 87,397,655	L234P	probably damaging	Het
Rnf145	A	G	11: 44,525,138	Y60C	probably damaging	Het
Rnf167	T	C	11: 70,649,699	I135T	probably damaging	Het
Rnf213	A	T	11: 119,414,469	I509F	probably damaging	Het
Ryr2	T	C	13: 11,869,156	S213G	probably damaging	Het
Selenbp1	T	C	3: 94,936,913	V27A	possibly damaging	Het
Selenof	T	G	3: 144,577,692	L14R	probably damaging	Het
Sfswap	A	T	5: 129,504,126	D121V	probably damaging	Het
Slc25a34	C	A	4: 141,620,469	M300I	possibly damaging	Het
Slc34a3	T	G	2: 25,229,110	T583P	probably benign	Het
Smg1	C	A	7: 118,182,468	A1199S	probably benign	Het
Spint1	A	G	2: 119,245,615	T231A	probably damaging	Het
Sptbn1	A	C	11: 30,149,576	N229K	probably damaging	Het
Sult2b1	A	G	7: 45,730,092		probably benign	Het
Tas2r123	A	T	6: 132,847,838	M233L	probably damaging	Het
Tbcel	C	A	9: 42,444,500	C139F	probably benign	Het
Thbs2	A	C	17: 14,679,973	S573A	probably benign	Het
Tmem132c	A	G	5: 127,563,705	E980G	probably damaging	Het
Tmem247	G	T	17: 86,922,322	C197F	probably damaging	Het
Tmem251	T	A	12: 102,744,876	Y119*	probably null	Het
Tmem43	C	A	6: 91,482,318	P257Q	probably benign	Het
Tmprss13	A	G	9: 45,337,132		probably null	Het
Trove2	G	T	1: 143,760,075	N444K	probably benign	Het
Vmn1r196	T	A	13: 22,293,836	V215D	probably damaging	Het
Vmn1r22	G	T	6: 57,900,332	T220K	probably benign	Het
Vmn2r116	G	A	17: 23,387,279	M388I	possibly damaging	Het
Vmn2r74	A	C	7: 85,961,410	C25G	probably damaging	Het
Xndc1	T	C	7: 102,080,616		probably benign	Het
Zfp282	A	G	6: 47,897,881	D340G	probably damaging	Het
Zfp282	T	A	6: 47,905,053	I558N	possibly damaging	Het
Zfp316	T	A	5: 143,264,491	T56S	unknown	Het
Zfp345	A	G	2: 150,474,559		probably benign	Het

Other mutations in Ubr5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Ubr5	APN	15	37984036	missense	probably damaging	1.00
IGL00548:Ubr5	APN	15	38004321	missense	probably benign	0.11
IGL00675:Ubr5	APN	15	38018284	missense	possibly damaging	0.84
IGL00770:Ubr5	APN	15	38006541	missense	probably benign	0.27
IGL00774:Ubr5	APN	15	38006541	missense	probably benign	0.27
IGL00919:Ubr5	APN	15	38040842	missense	probably damaging	1.00
IGL00962:Ubr5	APN	15	37985934	missense	probably damaging	1.00
IGL01328:Ubr5	APN	15	37981523	missense	possibly damaging	0.82
IGL01359:Ubr5	APN	15	37973006	missense	probably damaging	0.96
IGL01394:Ubr5	APN	15	38009631	missense	possibly damaging	0.90
IGL01674:Ubr5	APN	15	37998379	missense	probably damaging	1.00
IGL01981:Ubr5	APN	15	37996598	missense	probably benign	0.08
IGL01993:Ubr5	APN	15	37973012	missense	probably damaging	0.99
IGL02159:Ubr5	APN	15	37991379	splice site	probably benign
IGL02252:Ubr5	APN	15	38024894	missense	probably damaging	1.00
IGL02442:Ubr5	APN	15	38037901	missense	possibly damaging	0.95
IGL02502:Ubr5	APN	15	38030689	missense	probably benign	0.01
IGL02503:Ubr5	APN	15	38018320	missense	possibly damaging	0.90
IGL02503:Ubr5	APN	15	38018314	missense	probably damaging	0.99
IGL02546:Ubr5	APN	15	38008747	missense	probably benign	0.00
IGL02556:Ubr5	APN	15	38002448	missense	probably benign	0.18
IGL02647:Ubr5	APN	15	37992082	missense	probably damaging	0.99
IGL02679:Ubr5	APN	15	38002314	missense	probably benign	0.36
IGL02726:Ubr5	APN	15	38000562	splice site	probably benign
IGL02884:Ubr5	APN	15	37998376	missense	probably damaging	1.00
IGL02972:Ubr5	APN	15	38041952	missense	probably damaging	1.00
IGL03000:Ubr5	APN	15	38024852	missense	probably damaging	0.99
IGL03028:Ubr5	APN	15	38047593	missense	probably benign	0.00
IGL03057:Ubr5	APN	15	38040906	splice site	probably benign
IGL03085:Ubr5	APN	15	38029568	missense	probably damaging	1.00
IGL03198:Ubr5	APN	15	38045720	missense	probably damaging	1.00
IGL03368:Ubr5	APN	15	37998316	missense	probably damaging	0.96
Anchovy	UTSW	15	37979832	missense	probably null
P0016:Ubr5	UTSW	15	38000578	missense	probably damaging	1.00
PIT4142001:Ubr5	UTSW	15	38041909	missense
R0133:Ubr5	UTSW	15	37996571	missense	probably damaging	0.98
R0173:Ubr5	UTSW	15	38004675	missense	probably damaging	1.00
R0234:Ubr5	UTSW	15	37968493	missense	probably damaging	1.00
R0234:Ubr5	UTSW	15	37968493	missense	probably damaging	1.00
R0314:Ubr5	UTSW	15	37997187	missense	probably damaging	0.99
R0379:Ubr5	UTSW	15	38018957	missense	probably benign	0.00
R0390:Ubr5	UTSW	15	38030672	missense	probably benign	0.19
R0531:Ubr5	UTSW	15	37991344	missense	probably benign	0.34
R0650:Ubr5	UTSW	15	38030807	splice site	probably benign
R0720:Ubr5	UTSW	15	37972991	missense	probably damaging	0.98
R1183:Ubr5	UTSW	15	37997175	missense	possibly damaging	0.71
R1302:Ubr5	UTSW	15	38041479	missense	possibly damaging	0.91
R1442:Ubr5	UTSW	15	38014924	splice site	probably benign
R1507:Ubr5	UTSW	15	37980870	missense	probably damaging	1.00
R1575:Ubr5	UTSW	15	38040841	missense	probably damaging	1.00
R1577:Ubr5	UTSW	15	38030730	missense	possibly damaging	0.76
R1622:Ubr5	UTSW	15	38009113	unclassified	probably benign
R1721:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R1799:Ubr5	UTSW	15	37989377	missense	probably damaging	1.00
R1840:Ubr5	UTSW	15	37980917	missense	possibly damaging	0.51
R1867:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R1868:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R2065:Ubr5	UTSW	15	38040842	missense	probably damaging	1.00
R2107:Ubr5	UTSW	15	37989302	missense	probably benign	0.00
R2201:Ubr5	UTSW	15	38002299	missense	possibly damaging	0.83
R2261:Ubr5	UTSW	15	37988284	missense	probably damaging	0.99
R2441:Ubr5	UTSW	15	37989345	missense	probably damaging	0.99
R2512:Ubr5	UTSW	15	38002319	missense	probably damaging	1.00
R3008:Ubr5	UTSW	15	38030845	missense	probably benign
R3412:Ubr5	UTSW	15	38004235	splice site	probably benign
R3898:Ubr5	UTSW	15	37997739	missense	probably benign	0.02
R3900:Ubr5	UTSW	15	38019242	missense	probably damaging	1.00
R4032:Ubr5	UTSW	15	38024837	missense
R4352:Ubr5	UTSW	15	38041573	missense	probably benign	0.31
R4362:Ubr5	UTSW	15	38078403	missense	probably damaging	0.99
R4467:Ubr5	UTSW	15	38004336	missense	probably damaging	1.00
R4507:Ubr5	UTSW	15	38013542	missense	probably damaging	0.96
R4683:Ubr5	UTSW	15	38037967	missense	probably damaging	1.00
R4771:Ubr5	UTSW	15	38018297	missense	possibly damaging	0.50
R4878:Ubr5	UTSW	15	38006564	missense	probably benign	0.01
R4999:Ubr5	UTSW	15	38009668	missense	probably benign	0.06
R5057:Ubr5	UTSW	15	38004109	missense	probably damaging	0.98
R5177:Ubr5	UTSW	15	38006517	missense	probably benign	0.22
R5186:Ubr5	UTSW	15	37997916	missense	probably damaging	0.99
R5378:Ubr5	UTSW	15	37989578	missense	probably damaging	1.00
R5486:Ubr5	UTSW	15	38008739	missense	probably benign	0.00
R5494:Ubr5	UTSW	15	38019281	missense	possibly damaging	0.78
R5617:Ubr5	UTSW	15	38030657	missense	possibly damaging	0.47
R5636:Ubr5	UTSW	15	37983996	missense	probably damaging	1.00
R5655:Ubr5	UTSW	15	38015093	missense	probably damaging	0.99
R5715:Ubr5	UTSW	15	38002233	missense	probably benign	0.06
R5781:Ubr5	UTSW	15	38006541	missense	probably benign	0.27
R6645:Ubr5	UTSW	15	38029506	missense	probably damaging	1.00
R6774:Ubr5	UTSW	15	38015135	missense	probably damaging	1.00
R6823:Ubr5	UTSW	15	37989598	missense	probably benign	0.08
R6877:Ubr5	UTSW	15	38002570	missense	probably damaging	0.98
R7105:Ubr5	UTSW	15	38008775	missense
R7166:Ubr5	UTSW	15	37976145	missense
R7514:Ubr5	UTSW	15	37988237	missense
R7523:Ubr5	UTSW	15	38004055	missense
R7631:Ubr5	UTSW	15	38029507	missense
R7709:Ubr5	UTSW	15	37979832	missense	probably null
R7710:Ubr5	UTSW	15	37979832	missense	probably null
R7712:Ubr5	UTSW	15	37979832	missense	probably null
R7803:Ubr5	UTSW	15	37979832	missense	probably null
R7816:Ubr5	UTSW	15	37979832	missense	probably null
R7817:Ubr5	UTSW	15	37979832	missense	probably null
R7821:Ubr5	UTSW	15	37997187	missense	probably damaging	0.96
R7824:Ubr5	UTSW	15	37991322	missense	probably damaging	0.97
R7841:Ubr5	UTSW	15	37980906	missense
R7869:Ubr5	UTSW	15	37979832	missense	probably null
R7896:Ubr5	UTSW	15	38041573	missense	probably benign	0.31
R8191:Ubr5	UTSW	15	38006507	missense
R8342:Ubr5	UTSW	15	38024837	missense
R8745:Ubr5	UTSW	15	38024795	missense
R8811:Ubr5	UTSW	15	38040879	missense
R8904:Ubr5	UTSW	15	38041909	missense
R8955:Ubr5	UTSW	15	38029581	missense
R8956:Ubr5	UTSW	15	38015123	missense	probably damaging	1.00
R9051:Ubr5	UTSW	15	38002259	missense
R9102:Ubr5	UTSW	15	38018352	missense
R9183:Ubr5	UTSW	15	37997176	missense
R9235:Ubr5	UTSW	15	38045738	missense
R9392:Ubr5	UTSW	15	37984007	missense
R9473:Ubr5	UTSW	15	38002373	missense
RF024:Ubr5	UTSW	15	38028652	missense
X0024:Ubr5	UTSW	15	37992060	missense	probably damaging	1.00
Z1177:Ubr5	UTSW	15	38040755	missense

Predicted Primers

PCR Primer
(F):5'- GCAATGCTGCACTTTAGTCAACCC -3'
(R):5'- TCTCAGGTCAACTGGCATGACTTTG -3'

Sequencing Primer
(F):5'- ATGTCATGCACTGCCCTATAGAG -3'
(R):5'- catacacacacacacacacac -3'

Posted On

2013-05-23