Incidental Mutation 'R5282:Daw1'
ID402800
Institutional Source Beutler Lab
Gene Symbol Daw1
Ensembl Gene ENSMUSG00000053161
Gene Namedynein assembly factor with WDR repeat domains 1
Synonymsb2b1116Clo, 4930563E19Rik, 4933429D11Rik, Wdr69
MMRRC Submission 042867-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R5282 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location83159752-83210574 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 83192698 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 244 (V244L)
Ref Sequence ENSEMBL: ENSMUSP00000067583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065403] [ENSMUST00000065436] [ENSMUST00000113436] [ENSMUST00000149342]
Predicted Effect probably benign
Transcript: ENSMUST00000065403
AA Change: V244L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000067583
Gene: ENSMUSG00000053161
AA Change: V244L

DomainStartEndE-ValueType
WD40 81 120 1.17e-5 SMART
WD40 123 163 1.14e-8 SMART
WD40 166 205 1.95e-11 SMART
WD40 208 247 3.47e-8 SMART
WD40 250 289 2.98e-7 SMART
WD40 292 331 1.51e-8 SMART
WD40 334 373 4.87e-12 SMART
WD40 376 415 5.14e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065436
SMART Domains Protein: ENSMUSP00000067102
Gene: ENSMUSG00000053161

DomainStartEndE-ValueType
WD40 81 120 1.17e-5 SMART
WD40 145 184 3.37e-6 SMART
WD40 187 226 1.51e-8 SMART
WD40 229 268 4.87e-12 SMART
WD40 271 310 5.14e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113436
SMART Domains Protein: ENSMUSP00000109063
Gene: ENSMUSG00000053161

DomainStartEndE-ValueType
WD40 81 120 1.17e-5 SMART
WD40 145 184 3.37e-6 SMART
WD40 187 226 1.51e-8 SMART
WD40 229 268 4.87e-12 SMART
WD40 271 317 7.99e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149342
SMART Domains Protein: ENSMUSP00000117796
Gene: ENSMUSG00000053161

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an induced mutation exhibit dextrocardia associated with situs inversus totalis, overriding aorta, ventricular septal defects, and dual inferior vena cava as well as dextrogastria, hypoplastic spleen, inverted liver, lung lobation/isomerism and dyskinetic/immotile airway cilia [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik T A 9: 108,393,240 M1K probably null Het
2810021J22Rik T C 11: 58,880,340 L216S possibly damaging Het
4933405O20Rik G A 7: 50,599,472 E85K possibly damaging Het
Agrn A G 4: 156,173,035 F1153L probably damaging Het
Cbx8 A G 11: 119,038,916 S284P probably damaging Het
Cep128 A G 12: 91,339,119 L170P probably damaging Het
Cyp4f14 T A 17: 32,907,985 T324S probably damaging Het
Eef2kmt A G 16: 5,245,358 V306A probably benign Het
Enah A T 1: 181,935,728 probably null Het
Fam171b T C 2: 83,853,605 probably null Het
Fsip2 C T 2: 82,978,581 T1748I possibly damaging Het
Gabrg2 C T 11: 41,971,732 G175D probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hmcn1 G T 1: 150,582,296 N33K probably damaging Het
Incenp T A 19: 9,878,406 E514V unknown Het
Kank3 T C 17: 33,817,943 S74P probably benign Het
Lrriq1 G T 10: 103,215,345 N515K probably benign Het
Mfsd13b G A 7: 120,991,833 D266N probably damaging Het
Neto1 T C 18: 86,404,873 Y152H probably damaging Het
Nub1 C A 5: 24,695,535 F145L probably benign Het
Nufip1 T C 14: 76,114,275 probably null Het
Pard6g T A 18: 80,079,901 V50E probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Rapgef5 A C 12: 117,739,644 N431T probably damaging Het
Rassf9 A T 10: 102,545,344 T196S probably damaging Het
Rrp12 T C 19: 41,876,590 Y764C probably benign Het
Slfn8 T C 11: 83,017,724 probably null Het
Smox T A 2: 131,521,106 V265D probably damaging Het
Sult1b1 T C 5: 87,530,651 I105V probably benign Het
Sycp2 T C 2: 178,403,761 D22G probably damaging Het
Tbck G A 3: 132,751,216 M630I possibly damaging Het
Tenm4 G C 7: 96,837,331 G965R possibly damaging Het
Trappc10 G A 10: 78,187,860 T1258I probably damaging Het
Tssk1 G A 16: 17,895,259 G303S probably benign Het
Tstd2 T C 4: 46,120,461 Y313C probably damaging Het
Usp42 G A 5: 143,721,646 T260M probably damaging Het
Wdr43 T A 17: 71,648,777 V479E probably damaging Het
Xpo7 G A 14: 70,683,731 T599I probably damaging Het
Zfp553 A G 7: 127,236,841 K523E probably benign Het
Other mutations in Daw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Daw1 APN 1 83197236 missense probably damaging 1.00
IGL00717:Daw1 APN 1 83198179 missense probably benign 0.03
IGL01320:Daw1 APN 1 83198180 missense possibly damaging 0.82
IGL01869:Daw1 APN 1 83182244 splice site probably benign
IGL02404:Daw1 APN 1 83197231 missense probably benign 0.15
IGL02516:Daw1 APN 1 83209228 missense probably benign 0.03
IGL02608:Daw1 APN 1 83209334 nonsense probably null
IGL02992:Daw1 APN 1 83197213 splice site probably benign
IGL03015:Daw1 APN 1 83183382 splice site probably benign
IGL03099:Daw1 APN 1 83179367 critical splice donor site probably null
R0050:Daw1 UTSW 1 83180365 missense probably benign 0.01
R0631:Daw1 UTSW 1 83197260 missense probably damaging 1.00
R0711:Daw1 UTSW 1 83191338 splice site probably benign
R1420:Daw1 UTSW 1 83159827 missense possibly damaging 0.51
R1678:Daw1 UTSW 1 83183366 missense probably damaging 1.00
R1943:Daw1 UTSW 1 83209266 missense possibly damaging 0.91
R2006:Daw1 UTSW 1 83191345 missense probably damaging 1.00
R2191:Daw1 UTSW 1 83192663 missense probably benign 0.34
R4983:Daw1 UTSW 1 83187998 missense probably benign 0.38
R5129:Daw1 UTSW 1 83205903 missense probably damaging 0.99
R6128:Daw1 UTSW 1 83205926 nonsense probably null
R7438:Daw1 UTSW 1 83192715 missense probably benign
Z1088:Daw1 UTSW 1 83205964 missense probably null 1.00
Z1176:Daw1 UTSW 1 83180391 missense probably damaging 0.99
Z1176:Daw1 UTSW 1 83183300 missense probably damaging 1.00
Z1176:Daw1 UTSW 1 83209255 missense probably damaging 1.00
Z1177:Daw1 UTSW 1 83210214 missense unknown
Predicted Primers PCR Primer
(F):5'- CCTTGCAGAGAAAGTGGTGC -3'
(R):5'- TGCTGCCTTGTATTGGGAAATC -3'

Sequencing Primer
(F):5'- CGAGCCGGATTTCCTGTTGC -3'
(R):5'- CCAGACAAATTGTGGTGCTC -3'
Posted On2016-07-22