Incidental Mutation 'R5282:Tstd2'
ID402809
Institutional Source Beutler Lab
Gene Symbol Tstd2
Ensembl Gene ENSMUSG00000035495
Gene Namethiosulfate sulfurtransferase (rhodanese)-like domain containing 2
Synonyms
MMRRC Submission 042867-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R5282 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location46114746-46138694 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46120461 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 313 (Y313C)
Ref Sequence ENSEMBL: ENSMUSP00000103401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107770] [ENSMUST00000107772] [ENSMUST00000107773]
Predicted Effect probably damaging
Transcript: ENSMUST00000107770
AA Change: Y313C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103399
Gene: ENSMUSG00000035495
AA Change: Y313C

DomainStartEndE-ValueType
low complexity region 44 64 N/A INTRINSIC
RHOD 290 392 2.25e-11 SMART
Pfam:Rhodanese_C 396 459 2.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107772
AA Change: Y313C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103401
Gene: ENSMUSG00000035495
AA Change: Y313C

DomainStartEndE-ValueType
low complexity region 44 64 N/A INTRINSIC
RHOD 290 392 2.25e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107773
SMART Domains Protein: ENSMUSP00000103402
Gene: ENSMUSG00000028328

DomainStartEndE-ValueType
Pfam:Tropomodulin 3 143 6.3e-64 PFAM
PDB:1IO0|A 160 344 1e-115 PDB
SCOP:d1a4ya_ 181 312 3e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160008
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik T A 9: 108,393,240 M1K probably null Het
2810021J22Rik T C 11: 58,880,340 L216S possibly damaging Het
4933405O20Rik G A 7: 50,599,472 E85K possibly damaging Het
Agrn A G 4: 156,173,035 F1153L probably damaging Het
Cbx8 A G 11: 119,038,916 S284P probably damaging Het
Cep128 A G 12: 91,339,119 L170P probably damaging Het
Cyp4f14 T A 17: 32,907,985 T324S probably damaging Het
Daw1 G T 1: 83,192,698 V244L probably benign Het
Eef2kmt A G 16: 5,245,358 V306A probably benign Het
Enah A T 1: 181,935,728 probably null Het
Fam171b T C 2: 83,853,605 probably null Het
Fsip2 C T 2: 82,978,581 T1748I possibly damaging Het
Gabrg2 C T 11: 41,971,732 G175D probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hmcn1 G T 1: 150,582,296 N33K probably damaging Het
Incenp T A 19: 9,878,406 E514V unknown Het
Kank3 T C 17: 33,817,943 S74P probably benign Het
Lrriq1 G T 10: 103,215,345 N515K probably benign Het
Mfsd13b G A 7: 120,991,833 D266N probably damaging Het
Neto1 T C 18: 86,404,873 Y152H probably damaging Het
Nub1 C A 5: 24,695,535 F145L probably benign Het
Nufip1 T C 14: 76,114,275 probably null Het
Pard6g T A 18: 80,079,901 V50E probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Rapgef5 A C 12: 117,739,644 N431T probably damaging Het
Rassf9 A T 10: 102,545,344 T196S probably damaging Het
Rrp12 T C 19: 41,876,590 Y764C probably benign Het
Slfn8 T C 11: 83,017,724 probably null Het
Smox T A 2: 131,521,106 V265D probably damaging Het
Sult1b1 T C 5: 87,530,651 I105V probably benign Het
Sycp2 T C 2: 178,403,761 D22G probably damaging Het
Tbck G A 3: 132,751,216 M630I possibly damaging Het
Tenm4 G C 7: 96,837,331 G965R possibly damaging Het
Trappc10 G A 10: 78,187,860 T1258I probably damaging Het
Tssk1 G A 16: 17,895,259 G303S probably benign Het
Usp42 G A 5: 143,721,646 T260M probably damaging Het
Wdr43 T A 17: 71,648,777 V479E probably damaging Het
Xpo7 G A 14: 70,683,731 T599I probably damaging Het
Zfp553 A G 7: 127,236,841 K523E probably benign Het
Other mutations in Tstd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Tstd2 APN 4 46120002 unclassified probably benign
IGL02832:Tstd2 APN 4 46124949 missense probably damaging 1.00
curative UTSW 4 46116960 missense probably damaging 1.00
R1991:Tstd2 UTSW 4 46120563 missense probably benign 0.00
R2154:Tstd2 UTSW 4 46129235 missense probably damaging 0.98
R4381:Tstd2 UTSW 4 46119933 missense probably benign 0.01
R4643:Tstd2 UTSW 4 46129297 missense possibly damaging 0.92
R4961:Tstd2 UTSW 4 46120467 missense probably damaging 1.00
R5396:Tstd2 UTSW 4 46135542 missense probably benign 0.00
R7196:Tstd2 UTSW 4 46119955 missense probably damaging 1.00
R7535:Tstd2 UTSW 4 46116960 missense probably damaging 1.00
R7991:Tstd2 UTSW 4 46133646 missense unknown
Predicted Primers PCR Primer
(F):5'- TTTTCTCAGCAGACCTGGAG -3'
(R):5'- GCTTTGATGGAGACGCAGAG -3'

Sequencing Primer
(F):5'- TCAGCAGACCTGGAGCTCAG -3'
(R):5'- CACTTCAGTCAGATTAGGACAGCTAG -3'
Posted On2016-07-22