Incidental Mutation 'R5282:Sult1b1'
ID402813
Institutional Source Beutler Lab
Gene Symbol Sult1b1
Ensembl Gene ENSMUSG00000029269
Gene Namesulfotransferase family 1B, member 1
SynonymsDopa/tyrosine sulfotransferase
MMRRC Submission 042867-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5282 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location87513339-87538195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87530651 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 105 (I105V)
Ref Sequence ENSEMBL: ENSMUSP00000112844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031199] [ENSMUST00000117455] [ENSMUST00000120150]
Predicted Effect probably benign
Transcript: ENSMUST00000031199
AA Change: I105V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000031199
Gene: ENSMUSG00000029269
AA Change: I105V

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 38 289 7.5e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117455
AA Change: I105V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000112679
Gene: ENSMUSG00000029269
AA Change: I105V

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 38 289 7.5e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120150
AA Change: I105V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000112844
Gene: ENSMUSG00000029269
AA Change: I105V

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 38 289 7.5e-93 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. However, the total genomic length of this gene is greater than that of other SULT1 genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik T A 9: 108,393,240 M1K probably null Het
2810021J22Rik T C 11: 58,880,340 L216S possibly damaging Het
4933405O20Rik G A 7: 50,599,472 E85K possibly damaging Het
Agrn A G 4: 156,173,035 F1153L probably damaging Het
Cbx8 A G 11: 119,038,916 S284P probably damaging Het
Cep128 A G 12: 91,339,119 L170P probably damaging Het
Cyp4f14 T A 17: 32,907,985 T324S probably damaging Het
Daw1 G T 1: 83,192,698 V244L probably benign Het
Eef2kmt A G 16: 5,245,358 V306A probably benign Het
Enah A T 1: 181,935,728 probably null Het
Fam171b T C 2: 83,853,605 probably null Het
Fsip2 C T 2: 82,978,581 T1748I possibly damaging Het
Gabrg2 C T 11: 41,971,732 G175D probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hmcn1 G T 1: 150,582,296 N33K probably damaging Het
Incenp T A 19: 9,878,406 E514V unknown Het
Kank3 T C 17: 33,817,943 S74P probably benign Het
Lrriq1 G T 10: 103,215,345 N515K probably benign Het
Mfsd13b G A 7: 120,991,833 D266N probably damaging Het
Neto1 T C 18: 86,404,873 Y152H probably damaging Het
Nub1 C A 5: 24,695,535 F145L probably benign Het
Nufip1 T C 14: 76,114,275 probably null Het
Pard6g T A 18: 80,079,901 V50E probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Rapgef5 A C 12: 117,739,644 N431T probably damaging Het
Rassf9 A T 10: 102,545,344 T196S probably damaging Het
Rrp12 T C 19: 41,876,590 Y764C probably benign Het
Slfn8 T C 11: 83,017,724 probably null Het
Smox T A 2: 131,521,106 V265D probably damaging Het
Sycp2 T C 2: 178,403,761 D22G probably damaging Het
Tbck G A 3: 132,751,216 M630I possibly damaging Het
Tenm4 G C 7: 96,837,331 G965R possibly damaging Het
Trappc10 G A 10: 78,187,860 T1258I probably damaging Het
Tssk1 G A 16: 17,895,259 G303S probably benign Het
Tstd2 T C 4: 46,120,461 Y313C probably damaging Het
Usp42 G A 5: 143,721,646 T260M probably damaging Het
Wdr43 T A 17: 71,648,777 V479E probably damaging Het
Xpo7 G A 14: 70,683,731 T599I probably damaging Het
Zfp553 A G 7: 127,236,841 K523E probably benign Het
Other mutations in Sult1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Sult1b1 APN 5 87514956 missense probably benign 0.28
IGL02214:Sult1b1 APN 5 87535090 utr 5 prime probably benign
R0377:Sult1b1 UTSW 5 87517376 missense probably damaging 1.00
R0835:Sult1b1 UTSW 5 87517452 missense probably benign 0.00
R1850:Sult1b1 UTSW 5 87520841 missense probably damaging 1.00
R2059:Sult1b1 UTSW 5 87535033 missense probably damaging 0.98
R4792:Sult1b1 UTSW 5 87515047 missense probably damaging 1.00
R4904:Sult1b1 UTSW 5 87535053 missense probably benign 0.39
R5127:Sult1b1 UTSW 5 87521548 missense probably damaging 1.00
R5981:Sult1b1 UTSW 5 87534957 missense probably damaging 1.00
R6270:Sult1b1 UTSW 5 87517554 splice site probably null
R6442:Sult1b1 UTSW 5 87535053 missense probably benign 0.39
R7681:Sult1b1 UTSW 5 87530636 missense probably damaging 1.00
R8236:Sult1b1 UTSW 5 87521524 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAGCACCTTCTAGTGTAGGTCAG -3'
(R):5'- GGCTTAGAGGACAATGAGATAACTC -3'

Sequencing Primer
(F):5'- GGTCAGTTCTCCGTATTACAAAGC -3'
(R):5'- TCCCACAAGAGTGCTGTGACAG -3'
Posted On2016-07-22