Incidental Mutation 'R5282:Usp42'
ID402815
Institutional Source Beutler Lab
Gene Symbol Usp42
Ensembl Gene ENSMUSG00000051306
Gene Nameubiquitin specific peptidase 42
SynonymsA630018G05Rik, D5Ertd591e, 3110031A07Rik, 2410140K03Rik
MMRRC Submission 042867-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5282 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location143710325-143732280 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 143721646 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 260 (T260M)
Ref Sequence ENSEMBL: ENSMUSP00000053955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053287]
Predicted Effect probably damaging
Transcript: ENSMUST00000053287
AA Change: T260M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053955
Gene: ENSMUSG00000051306
AA Change: T260M

DomainStartEndE-ValueType
low complexity region 65 77 N/A INTRINSIC
Pfam:UCH 109 408 1.4e-46 PFAM
Pfam:UCH_1 110 391 1.4e-18 PFAM
low complexity region 470 490 N/A INTRINSIC
low complexity region 567 579 N/A INTRINSIC
low complexity region 604 613 N/A INTRINSIC
low complexity region 634 645 N/A INTRINSIC
low complexity region 954 962 N/A INTRINSIC
low complexity region 1016 1031 N/A INTRINSIC
low complexity region 1201 1219 N/A INTRINSIC
low complexity region 1239 1255 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155408
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit fecundity and behavioral abnormalities, hyperactivity, increased T cell number, abnormal lens morphology, and cataracts. Males display oligozoospermia and testis degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik T A 9: 108,393,240 M1K probably null Het
2810021J22Rik T C 11: 58,880,340 L216S possibly damaging Het
4933405O20Rik G A 7: 50,599,472 E85K possibly damaging Het
Agrn A G 4: 156,173,035 F1153L probably damaging Het
Cbx8 A G 11: 119,038,916 S284P probably damaging Het
Cep128 A G 12: 91,339,119 L170P probably damaging Het
Cyp4f14 T A 17: 32,907,985 T324S probably damaging Het
Daw1 G T 1: 83,192,698 V244L probably benign Het
Eef2kmt A G 16: 5,245,358 V306A probably benign Het
Enah A T 1: 181,935,728 probably null Het
Fam171b T C 2: 83,853,605 probably null Het
Fsip2 C T 2: 82,978,581 T1748I possibly damaging Het
Gabrg2 C T 11: 41,971,732 G175D probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hmcn1 G T 1: 150,582,296 N33K probably damaging Het
Incenp T A 19: 9,878,406 E514V unknown Het
Kank3 T C 17: 33,817,943 S74P probably benign Het
Lrriq1 G T 10: 103,215,345 N515K probably benign Het
Mfsd13b G A 7: 120,991,833 D266N probably damaging Het
Neto1 T C 18: 86,404,873 Y152H probably damaging Het
Nub1 C A 5: 24,695,535 F145L probably benign Het
Nufip1 T C 14: 76,114,275 probably null Het
Pard6g T A 18: 80,079,901 V50E probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Rapgef5 A C 12: 117,739,644 N431T probably damaging Het
Rassf9 A T 10: 102,545,344 T196S probably damaging Het
Rrp12 T C 19: 41,876,590 Y764C probably benign Het
Slfn8 T C 11: 83,017,724 probably null Het
Smox T A 2: 131,521,106 V265D probably damaging Het
Sult1b1 T C 5: 87,530,651 I105V probably benign Het
Sycp2 T C 2: 178,403,761 D22G probably damaging Het
Tbck G A 3: 132,751,216 M630I possibly damaging Het
Tenm4 G C 7: 96,837,331 G965R possibly damaging Het
Trappc10 G A 10: 78,187,860 T1258I probably damaging Het
Tssk1 G A 16: 17,895,259 G303S probably benign Het
Tstd2 T C 4: 46,120,461 Y313C probably damaging Het
Wdr43 T A 17: 71,648,777 V479E probably damaging Het
Xpo7 G A 14: 70,683,731 T599I probably damaging Het
Zfp553 A G 7: 127,236,841 K523E probably benign Het
Other mutations in Usp42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Usp42 APN 5 143717142 missense probably benign 0.00
IGL00902:Usp42 APN 5 143719874 splice site probably benign
IGL01326:Usp42 APN 5 143721215 missense possibly damaging 0.54
IGL01985:Usp42 APN 5 143715185 missense probably damaging 1.00
IGL02629:Usp42 APN 5 143723154 missense possibly damaging 0.94
IGL02683:Usp42 APN 5 143715346 missense possibly damaging 0.55
IGL02700:Usp42 APN 5 143717128 missense probably benign 0.01
IGL02965:Usp42 APN 5 143728014 missense probably damaging 1.00
PIT4468001:Usp42 UTSW 5 143714644 missense probably damaging 1.00
R0043:Usp42 UTSW 5 143714710 missense probably benign 0.09
R0043:Usp42 UTSW 5 143714710 missense probably benign 0.09
R0420:Usp42 UTSW 5 143714861 missense probably damaging 0.99
R1066:Usp42 UTSW 5 143718041 missense probably damaging 1.00
R1345:Usp42 UTSW 5 143717333 missense probably damaging 1.00
R1628:Usp42 UTSW 5 143717367 missense probably damaging 1.00
R1728:Usp42 UTSW 5 143714626 missense probably damaging 1.00
R1729:Usp42 UTSW 5 143714626 missense probably damaging 1.00
R1767:Usp42 UTSW 5 143714866 missense possibly damaging 0.69
R1772:Usp42 UTSW 5 143717102 missense probably damaging 1.00
R1784:Usp42 UTSW 5 143714626 missense probably damaging 1.00
R1916:Usp42 UTSW 5 143715056 missense probably damaging 1.00
R2425:Usp42 UTSW 5 143715839 missense probably benign 0.09
R2867:Usp42 UTSW 5 143715464 missense possibly damaging 0.52
R2867:Usp42 UTSW 5 143715464 missense possibly damaging 0.52
R2886:Usp42 UTSW 5 143721629 splice site probably benign
R3195:Usp42 UTSW 5 143717199 missense probably benign 0.02
R3737:Usp42 UTSW 5 143715439 missense probably benign 0.00
R3738:Usp42 UTSW 5 143715439 missense probably benign 0.00
R4034:Usp42 UTSW 5 143715439 missense probably benign 0.00
R4795:Usp42 UTSW 5 143723937 missense probably damaging 1.00
R4940:Usp42 UTSW 5 143719762 missense probably damaging 1.00
R4967:Usp42 UTSW 5 143715364 missense possibly damaging 0.71
R5773:Usp42 UTSW 5 143713712 missense probably benign 0.03
R5778:Usp42 UTSW 5 143719576 missense probably damaging 1.00
R5933:Usp42 UTSW 5 143715515 missense probably benign 0.00
R6192:Usp42 UTSW 5 143717187 missense possibly damaging 0.73
R6275:Usp42 UTSW 5 143714972 missense probably damaging 1.00
R6496:Usp42 UTSW 5 143715103 missense probably damaging 1.00
R6825:Usp42 UTSW 5 143727807 missense probably damaging 1.00
R6939:Usp42 UTSW 5 143727969 missense probably damaging 1.00
R7099:Usp42 UTSW 5 143726645 missense probably damaging 1.00
R7356:Usp42 UTSW 5 143717087 missense possibly damaging 0.56
R7876:Usp42 UTSW 5 143721671 missense probably damaging 1.00
R8243:Usp42 UTSW 5 143715094 missense probably benign 0.01
X0022:Usp42 UTSW 5 143716060 frame shift probably null
X0027:Usp42 UTSW 5 143717078 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GAACTCTGAGAGGCAAGTTTTG -3'
(R):5'- GACTAGGCTCATCGCACTTC -3'

Sequencing Primer
(F):5'- TCTATAATCAGAAAAGCAAAAGCTCC -3'
(R):5'- CTTCTACCCACAGTACAGAGTATC -3'
Posted On2016-07-22