Incidental Mutation 'R5282:Mfsd13b'
ID402819
Institutional Source Beutler Lab
Gene Symbol Mfsd13b
Ensembl Gene ENSMUSG00000030877
Gene Namemajor facilitator superfamily domain containing 13B
Synonyms4933427G17Rik
MMRRC Submission 042867-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R5282 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location120982509-121014787 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120991833 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 266 (D266N)
Ref Sequence ENSEMBL: ENSMUSP00000150654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033166] [ENSMUST00000138177] [ENSMUST00000149535] [ENSMUST00000216241]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033166
AA Change: D266N

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000033166
Gene: ENSMUSG00000030877
AA Change: D266N

DomainStartEndE-ValueType
Pfam:MFS_2 9 439 5.1e-18 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000133939
AA Change: D4N
SMART Domains Protein: ENSMUSP00000121409
Gene: ENSMUSG00000030877
AA Change: D4N

DomainStartEndE-ValueType
transmembrane domain 48 67 N/A INTRINSIC
transmembrane domain 74 96 N/A INTRINSIC
transmembrane domain 131 153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138177
Predicted Effect probably benign
Transcript: ENSMUST00000149535
SMART Domains Protein: ENSMUSP00000115341
Gene: ENSMUSG00000030877

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000216241
AA Change: D266N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik T A 9: 108,393,240 M1K probably null Het
2810021J22Rik T C 11: 58,880,340 L216S possibly damaging Het
4933405O20Rik G A 7: 50,599,472 E85K possibly damaging Het
Agrn A G 4: 156,173,035 F1153L probably damaging Het
Cbx8 A G 11: 119,038,916 S284P probably damaging Het
Cep128 A G 12: 91,339,119 L170P probably damaging Het
Cyp4f14 T A 17: 32,907,985 T324S probably damaging Het
Daw1 G T 1: 83,192,698 V244L probably benign Het
Eef2kmt A G 16: 5,245,358 V306A probably benign Het
Enah A T 1: 181,935,728 probably null Het
Fam171b T C 2: 83,853,605 probably null Het
Fsip2 C T 2: 82,978,581 T1748I possibly damaging Het
Gabrg2 C T 11: 41,971,732 G175D probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hmcn1 G T 1: 150,582,296 N33K probably damaging Het
Incenp T A 19: 9,878,406 E514V unknown Het
Kank3 T C 17: 33,817,943 S74P probably benign Het
Lrriq1 G T 10: 103,215,345 N515K probably benign Het
Neto1 T C 18: 86,404,873 Y152H probably damaging Het
Nub1 C A 5: 24,695,535 F145L probably benign Het
Nufip1 T C 14: 76,114,275 probably null Het
Pard6g T A 18: 80,079,901 V50E probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Rapgef5 A C 12: 117,739,644 N431T probably damaging Het
Rassf9 A T 10: 102,545,344 T196S probably damaging Het
Rrp12 T C 19: 41,876,590 Y764C probably benign Het
Slfn8 T C 11: 83,017,724 probably null Het
Smox T A 2: 131,521,106 V265D probably damaging Het
Sult1b1 T C 5: 87,530,651 I105V probably benign Het
Sycp2 T C 2: 178,403,761 D22G probably damaging Het
Tbck G A 3: 132,751,216 M630I possibly damaging Het
Tenm4 G C 7: 96,837,331 G965R possibly damaging Het
Trappc10 G A 10: 78,187,860 T1258I probably damaging Het
Tssk1 G A 16: 17,895,259 G303S probably benign Het
Tstd2 T C 4: 46,120,461 Y313C probably damaging Het
Usp42 G A 5: 143,721,646 T260M probably damaging Het
Wdr43 T A 17: 71,648,777 V479E probably damaging Het
Xpo7 G A 14: 70,683,731 T599I probably damaging Het
Zfp553 A G 7: 127,236,841 K523E probably benign Het
Other mutations in Mfsd13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02302:Mfsd13b APN 7 120998909 missense probably damaging 1.00
IGL02985:Mfsd13b APN 7 121000172 missense probably damaging 1.00
R1159:Mfsd13b UTSW 7 121014543 missense probably damaging 0.98
R2041:Mfsd13b UTSW 7 120991916 splice site probably benign
R2080:Mfsd13b UTSW 7 120991824 missense probably null
R4762:Mfsd13b UTSW 7 120991326 missense probably damaging 1.00
R4885:Mfsd13b UTSW 7 120991488 missense possibly damaging 0.80
R5082:Mfsd13b UTSW 7 120998978 missense possibly damaging 0.94
R5296:Mfsd13b UTSW 7 120991738 missense probably damaging 1.00
R5411:Mfsd13b UTSW 7 121000123 missense probably benign 0.03
R6563:Mfsd13b UTSW 7 120995467 missense probably damaging 0.99
R7347:Mfsd13b UTSW 7 120991728 missense probably benign 0.44
R8128:Mfsd13b UTSW 7 120991272 missense possibly damaging 0.79
Z1176:Mfsd13b UTSW 7 120991677 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GTGGCATGTTCAATGTGAGACAG -3'
(R):5'- GACTGGGCTCTGACTCTTAGTG -3'

Sequencing Primer
(F):5'- CATGTTCAATGTGAGACAGTTTGAG -3'
(R):5'- GCTCTGACTCTTAGTGTTTGTTAG -3'
Posted On2016-07-22