Incidental Mutation 'R5282:Nufip1'
ID402835
Institutional Source Beutler Lab
Gene Symbol Nufip1
Ensembl Gene ENSMUSG00000022009
Gene Namenuclear fragile X mental retardation protein interacting protein 1
Synonyms
MMRRC Submission 042867-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5282 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location76110891-76137379 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 76114275 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022585] [ENSMUST00000022586]
Predicted Effect probably benign
Transcript: ENSMUST00000022585
SMART Domains Protein: ENSMUSP00000022585
Gene: ENSMUSG00000022008

DomainStartEndE-ValueType
low complexity region 41 67 N/A INTRINSIC
low complexity region 105 117 N/A INTRINSIC
Pfam:DUF3752 202 338 8.9e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000022586
SMART Domains Protein: ENSMUSP00000022586
Gene: ENSMUSG00000022009

DomainStartEndE-ValueType
low complexity region 38 48 N/A INTRINSIC
low complexity region 80 99 N/A INTRINSIC
ZnF_C2H2 165 187 3.58e-2 SMART
ZnF_C2H2 188 212 5.4e1 SMART
low complexity region 291 304 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear RNA binding protein that contains a C2H2 zinc finger motif and a nuclear localization signal. This protein is associated with the nuclear matrix in perichromatin fibrils and, in neurons, localizes to the cytoplasm in association with endoplasmic reticulum ribosomes. This protein interacts with the fragile X mental retardation protein (FMRP), the tumor suppressor protein BRCA1, upregulates RNA polymerase II transcription, and is involved in box C/D snoRNP biogenesis. A pseudogene of this gene resides on chromosome 6q12. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik T A 9: 108,393,240 M1K probably null Het
2810021J22Rik T C 11: 58,880,340 L216S possibly damaging Het
4933405O20Rik G A 7: 50,599,472 E85K possibly damaging Het
Agrn A G 4: 156,173,035 F1153L probably damaging Het
Cbx8 A G 11: 119,038,916 S284P probably damaging Het
Cep128 A G 12: 91,339,119 L170P probably damaging Het
Cyp4f14 T A 17: 32,907,985 T324S probably damaging Het
Daw1 G T 1: 83,192,698 V244L probably benign Het
Eef2kmt A G 16: 5,245,358 V306A probably benign Het
Enah A T 1: 181,935,728 probably null Het
Fam171b T C 2: 83,853,605 probably null Het
Fsip2 C T 2: 82,978,581 T1748I possibly damaging Het
Gabrg2 C T 11: 41,971,732 G175D probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hmcn1 G T 1: 150,582,296 N33K probably damaging Het
Incenp T A 19: 9,878,406 E514V unknown Het
Kank3 T C 17: 33,817,943 S74P probably benign Het
Lrriq1 G T 10: 103,215,345 N515K probably benign Het
Mfsd13b G A 7: 120,991,833 D266N probably damaging Het
Neto1 T C 18: 86,404,873 Y152H probably damaging Het
Nub1 C A 5: 24,695,535 F145L probably benign Het
Pard6g T A 18: 80,079,901 V50E probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Rapgef5 A C 12: 117,739,644 N431T probably damaging Het
Rassf9 A T 10: 102,545,344 T196S probably damaging Het
Rrp12 T C 19: 41,876,590 Y764C probably benign Het
Slfn8 T C 11: 83,017,724 probably null Het
Smox T A 2: 131,521,106 V265D probably damaging Het
Sult1b1 T C 5: 87,530,651 I105V probably benign Het
Sycp2 T C 2: 178,403,761 D22G probably damaging Het
Tbck G A 3: 132,751,216 M630I possibly damaging Het
Tenm4 G C 7: 96,837,331 G965R possibly damaging Het
Trappc10 G A 10: 78,187,860 T1258I probably damaging Het
Tssk1 G A 16: 17,895,259 G303S probably benign Het
Tstd2 T C 4: 46,120,461 Y313C probably damaging Het
Usp42 G A 5: 143,721,646 T260M probably damaging Het
Wdr43 T A 17: 71,648,777 V479E probably damaging Het
Xpo7 G A 14: 70,683,731 T599I probably damaging Het
Zfp553 A G 7: 127,236,841 K523E probably benign Het
Other mutations in Nufip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03035:Nufip1 APN 14 76115818 missense probably damaging 1.00
R0748:Nufip1 UTSW 14 76111068 missense probably damaging 1.00
R1576:Nufip1 UTSW 14 76134870 missense probably benign 0.00
R1641:Nufip1 UTSW 14 76126252 missense possibly damaging 0.55
R1992:Nufip1 UTSW 14 76134847 missense probably damaging 1.00
R5093:Nufip1 UTSW 14 76110973 missense probably benign 0.12
R5191:Nufip1 UTSW 14 76111989 missense probably damaging 1.00
R5212:Nufip1 UTSW 14 76133098 missense possibly damaging 0.72
R5635:Nufip1 UTSW 14 76126146 missense probably damaging 1.00
R5916:Nufip1 UTSW 14 76134900 makesense probably null
R5990:Nufip1 UTSW 14 76114188 missense probably damaging 0.99
R6328:Nufip1 UTSW 14 76111054 missense possibly damaging 0.62
R6333:Nufip1 UTSW 14 76111985 missense probably damaging 1.00
R6697:Nufip1 UTSW 14 76133073 missense probably benign 0.09
R7129:Nufip1 UTSW 14 76134885 missense possibly damaging 0.82
R7585:Nufip1 UTSW 14 76110987 missense probably benign 0.02
R7670:Nufip1 UTSW 14 76111974 frame shift probably null
R7848:Nufip1 UTSW 14 76114221 missense probably damaging 1.00
R7912:Nufip1 UTSW 14 76115002 missense possibly damaging 0.90
R7982:Nufip1 UTSW 14 76126239 missense probably benign
R8202:Nufip1 UTSW 14 76111164 missense probably benign 0.03
X0067:Nufip1 UTSW 14 76130861 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTAAAGGAAGCCTCCCCAC -3'
(R):5'- TCAAGACAGCTACAGAGGGC -3'

Sequencing Primer
(F):5'- CCCCAGGGGTATGTTTTAAAAC -3'
(R):5'- ACTCAGAGTCTCTCCTAGGGTGAC -3'
Posted On2016-07-22