Incidental Mutation 'R5282:Eef2kmt'
ID402836
Institutional Source Beutler Lab
Gene Symbol Eef2kmt
Ensembl Gene ENSMUSG00000022544
Gene Nameeukaryotic elongation factor 2 lysine methyltransferase
Synonyms5730409G15Rik, Fam86
MMRRC Submission 042867-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5282 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location5244152-5255983 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5245358 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 306 (V306A)
Ref Sequence ENSEMBL: ENSMUSP00000068003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049207] [ENSMUST00000064635] [ENSMUST00000100196] [ENSMUST00000139584]
Predicted Effect probably benign
Transcript: ENSMUST00000049207
SMART Domains Protein: ENSMUSP00000046534
Gene: ENSMUSG00000039427

DomainStartEndE-ValueType
transmembrane domain 5 23 N/A INTRINSIC
Pfam:Glycos_transf_1 246 422 8e-14 PFAM
Pfam:Glyco_trans_1_4 250 400 1.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064635
AA Change: V306A

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000068003
Gene: ENSMUSG00000022544
AA Change: V306A

DomainStartEndE-ValueType
Pfam:FAM86 6 99 2.7e-42 PFAM
Pfam:Methyltransf_16 119 299 2.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100196
SMART Domains Protein: ENSMUSP00000097770
Gene: ENSMUSG00000039427

DomainStartEndE-ValueType
transmembrane domain 5 23 N/A INTRINSIC
Pfam:Glycos_transf_1 270 447 2.4e-13 PFAM
Pfam:Glyco_trans_1_4 276 426 1.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132225
Predicted Effect probably benign
Transcript: ENSMUST00000139584
SMART Domains Protein: ENSMUSP00000123572
Gene: ENSMUSG00000022544

DomainStartEndE-ValueType
Pfam:FAM86 1 100 2.7e-62 PFAM
Pfam:Methyltransf_16 119 299 2e-23 PFAM
low complexity region 311 322 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230238
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik T A 9: 108,393,240 M1K probably null Het
2810021J22Rik T C 11: 58,880,340 L216S possibly damaging Het
4933405O20Rik G A 7: 50,599,472 E85K possibly damaging Het
Agrn A G 4: 156,173,035 F1153L probably damaging Het
Cbx8 A G 11: 119,038,916 S284P probably damaging Het
Cep128 A G 12: 91,339,119 L170P probably damaging Het
Cyp4f14 T A 17: 32,907,985 T324S probably damaging Het
Daw1 G T 1: 83,192,698 V244L probably benign Het
Enah A T 1: 181,935,728 probably null Het
Fam171b T C 2: 83,853,605 probably null Het
Fsip2 C T 2: 82,978,581 T1748I possibly damaging Het
Gabrg2 C T 11: 41,971,732 G175D probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hmcn1 G T 1: 150,582,296 N33K probably damaging Het
Incenp T A 19: 9,878,406 E514V unknown Het
Kank3 T C 17: 33,817,943 S74P probably benign Het
Lrriq1 G T 10: 103,215,345 N515K probably benign Het
Mfsd13b G A 7: 120,991,833 D266N probably damaging Het
Neto1 T C 18: 86,404,873 Y152H probably damaging Het
Nub1 C A 5: 24,695,535 F145L probably benign Het
Nufip1 T C 14: 76,114,275 probably null Het
Pard6g T A 18: 80,079,901 V50E probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Rapgef5 A C 12: 117,739,644 N431T probably damaging Het
Rassf9 A T 10: 102,545,344 T196S probably damaging Het
Rrp12 T C 19: 41,876,590 Y764C probably benign Het
Slfn8 T C 11: 83,017,724 probably null Het
Smox T A 2: 131,521,106 V265D probably damaging Het
Sult1b1 T C 5: 87,530,651 I105V probably benign Het
Sycp2 T C 2: 178,403,761 D22G probably damaging Het
Tbck G A 3: 132,751,216 M630I possibly damaging Het
Tenm4 G C 7: 96,837,331 G965R possibly damaging Het
Trappc10 G A 10: 78,187,860 T1258I probably damaging Het
Tssk1 G A 16: 17,895,259 G303S probably benign Het
Tstd2 T C 4: 46,120,461 Y313C probably damaging Het
Usp42 G A 5: 143,721,646 T260M probably damaging Het
Wdr43 T A 17: 71,648,777 V479E probably damaging Het
Xpo7 G A 14: 70,683,731 T599I probably damaging Het
Zfp553 A G 7: 127,236,841 K523E probably benign Het
Other mutations in Eef2kmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2259:Eef2kmt UTSW 16 5245308 missense probably benign 0.30
R2267:Eef2kmt UTSW 16 5255940 start gained probably benign
R4036:Eef2kmt UTSW 16 5245271 missense probably damaging 0.98
R4037:Eef2kmt UTSW 16 5245271 missense probably damaging 0.98
R4038:Eef2kmt UTSW 16 5245271 missense probably damaging 0.98
R4088:Eef2kmt UTSW 16 5253035 missense probably damaging 1.00
R4836:Eef2kmt UTSW 16 5249003 missense probably damaging 0.98
R4974:Eef2kmt UTSW 16 5249012 missense probably benign 0.14
R5023:Eef2kmt UTSW 16 5247599 missense probably damaging 1.00
R5444:Eef2kmt UTSW 16 5249095 intron probably benign
R5635:Eef2kmt UTSW 16 5249029 missense probably damaging 0.99
R6616:Eef2kmt UTSW 16 5247482 missense probably damaging 0.98
R7320:Eef2kmt UTSW 16 5250509 missense possibly damaging 0.93
R7343:Eef2kmt UTSW 16 5247435 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAACAGAAGCCTTTCCGC -3'
(R):5'- TACCTTTAGACCAAGCGTGCC -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- TTAGACCAAGCGTGCCCACAG -3'
Posted On2016-07-22