Incidental Mutation 'R5282:Tssk1'
ID402837
Institutional Source Beutler Lab
Gene Symbol Tssk1
Ensembl Gene ENSMUSG00000041566
Gene Nametestis-specific serine kinase 1
SynonymsStk22a, TSK-1, Tssk, Tsk1
MMRRC Submission 042867-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R5282 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location17894223-17897922 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 17895259 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 303 (G303S)
Ref Sequence ENSEMBL: ENSMUSP00000040302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012152] [ENSMUST00000046937] [ENSMUST00000055374] [ENSMUST00000066127] [ENSMUST00000117082] [ENSMUST00000117945] [ENSMUST00000150068] [ENSMUST00000155943]
Predicted Effect probably benign
Transcript: ENSMUST00000012152
SMART Domains Protein: ENSMUSP00000012152
Gene: ENSMUSG00000003166

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 6.28e-11 SMART
CLECT 114 265 1.06e-14 SMART
VWC 270 331 1.42e-9 SMART
transmembrane domain 345 367 N/A INTRINSIC
low complexity region 369 377 N/A INTRINSIC
low complexity region 438 449 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000046937
AA Change: G303S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040302
Gene: ENSMUSG00000041566
AA Change: G303S

DomainStartEndE-ValueType
S_TKc 12 272 3.86e-89 SMART
low complexity region 315 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055374
SMART Domains Protein: ENSMUSP00000051035
Gene: ENSMUSG00000045521

DomainStartEndE-ValueType
S_TKc 12 272 1.39e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066127
SMART Domains Protein: ENSMUSP00000064603
Gene: ENSMUSG00000003166

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 6.28e-11 SMART
CLECT 111 262 1.06e-14 SMART
transmembrane domain 274 296 N/A INTRINSIC
low complexity region 298 306 N/A INTRINSIC
low complexity region 367 378 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117082
SMART Domains Protein: ENSMUSP00000113506
Gene: ENSMUSG00000003166

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 5.86e-11 SMART
CLECT 113 264 1.06e-14 SMART
VWC 269 330 1.42e-9 SMART
transmembrane domain 344 366 N/A INTRINSIC
low complexity region 368 376 N/A INTRINSIC
low complexity region 437 448 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117945
SMART Domains Protein: ENSMUSP00000112783
Gene: ENSMUSG00000003166

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 6.28e-11 SMART
CLECT 111 262 1.06e-14 SMART
VWC 267 328 1.42e-9 SMART
transmembrane domain 342 364 N/A INTRINSIC
low complexity region 366 374 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126919
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135229
Predicted Effect probably benign
Transcript: ENSMUST00000150068
SMART Domains Protein: ENSMUSP00000115071
Gene: ENSMUSG00000092470

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 6.28e-11 SMART
CLECT 114 265 1.06e-14 SMART
VWC 270 331 1.42e-9 SMART
transmembrane domain 345 367 N/A INTRINSIC
low complexity region 369 377 N/A INTRINSIC
low complexity region 438 449 N/A INTRINSIC
low complexity region 559 565 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155611
Predicted Effect probably benign
Transcript: ENSMUST00000155943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231750
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TSSK1 belongs to a family of serine/threonine kinases highly expressed in testis (Hao et al., 2004 [PubMed 15044604]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele of Tssk1 and 2 are infertile due to arrested spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik T A 9: 108,393,240 M1K probably null Het
2810021J22Rik T C 11: 58,880,340 L216S possibly damaging Het
4933405O20Rik G A 7: 50,599,472 E85K possibly damaging Het
Agrn A G 4: 156,173,035 F1153L probably damaging Het
Cbx8 A G 11: 119,038,916 S284P probably damaging Het
Cep128 A G 12: 91,339,119 L170P probably damaging Het
Cyp4f14 T A 17: 32,907,985 T324S probably damaging Het
Daw1 G T 1: 83,192,698 V244L probably benign Het
Eef2kmt A G 16: 5,245,358 V306A probably benign Het
Enah A T 1: 181,935,728 probably null Het
Fam171b T C 2: 83,853,605 probably null Het
Fsip2 C T 2: 82,978,581 T1748I possibly damaging Het
Gabrg2 C T 11: 41,971,732 G175D probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hmcn1 G T 1: 150,582,296 N33K probably damaging Het
Incenp T A 19: 9,878,406 E514V unknown Het
Kank3 T C 17: 33,817,943 S74P probably benign Het
Lrriq1 G T 10: 103,215,345 N515K probably benign Het
Mfsd13b G A 7: 120,991,833 D266N probably damaging Het
Neto1 T C 18: 86,404,873 Y152H probably damaging Het
Nub1 C A 5: 24,695,535 F145L probably benign Het
Nufip1 T C 14: 76,114,275 probably null Het
Pard6g T A 18: 80,079,901 V50E probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Rapgef5 A C 12: 117,739,644 N431T probably damaging Het
Rassf9 A T 10: 102,545,344 T196S probably damaging Het
Rrp12 T C 19: 41,876,590 Y764C probably benign Het
Slfn8 T C 11: 83,017,724 probably null Het
Smox T A 2: 131,521,106 V265D probably damaging Het
Sult1b1 T C 5: 87,530,651 I105V probably benign Het
Sycp2 T C 2: 178,403,761 D22G probably damaging Het
Tbck G A 3: 132,751,216 M630I possibly damaging Het
Tenm4 G C 7: 96,837,331 G965R possibly damaging Het
Trappc10 G A 10: 78,187,860 T1258I probably damaging Het
Tstd2 T C 4: 46,120,461 Y313C probably damaging Het
Usp42 G A 5: 143,721,646 T260M probably damaging Het
Wdr43 T A 17: 71,648,777 V479E probably damaging Het
Xpo7 G A 14: 70,683,731 T599I probably damaging Het
Zfp553 A G 7: 127,236,841 K523E probably benign Het
Other mutations in Tssk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02016:Tssk1 APN 16 17894894 missense probably damaging 1.00
R4785:Tssk1 UTSW 16 17895062 missense probably benign 0.01
R5613:Tssk1 UTSW 16 17894500 missense probably benign 0.35
R5945:Tssk1 UTSW 16 17894701 missense probably damaging 1.00
R6085:Tssk1 UTSW 16 17894984 missense possibly damaging 0.82
R6246:Tssk1 UTSW 16 17895439 missense probably benign 0.06
R7537:Tssk1 UTSW 16 17895084 missense probably benign 0.05
R7818:Tssk1 UTSW 16 17894447 missense probably benign 0.01
X0010:Tssk1 UTSW 16 17895224 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- ACGCTCTAAACACCTGACTGG -3'
(R):5'- CTGCAAGAGGCTCACTAAGTATG -3'

Sequencing Primer
(F):5'- GTGAGTGCAAGGACCTCATCTAC -3'
(R):5'- CAAGAGGCTCACTAAGTATGTGTCTC -3'
Posted On2016-07-22