Incidental Mutation 'R5282:Cyp4f14'
ID402838
Institutional Source Beutler Lab
Gene Symbol Cyp4f14
Ensembl Gene ENSMUSG00000024292
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 14
Synonymsleukotriene B4 omega hydroxylase, 1300014O15Rik
MMRRC Submission 042867-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5282 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location32905071-32917342 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32907985 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 324 (T324S)
Ref Sequence ENSEMBL: ENSMUSP00000136139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054174] [ENSMUST00000179434]
Predicted Effect probably damaging
Transcript: ENSMUST00000054174
AA Change: T324S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050478
Gene: ENSMUSG00000024292
AA Change: T324S

DomainStartEndE-ValueType
Pfam:p450 52 515 2.7e-136 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179434
AA Change: T324S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136139
Gene: ENSMUSG00000024292
AA Change: T324S

DomainStartEndE-ValueType
Pfam:p450 52 515 2.7e-136 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein likely localizes to the endoplasmic reticulum. When expressed in yeast the enzyme is capable of oxdizing arachidonic acid. It can also catalyze the epoxidation of 22:6n-3 and 22:5n-3 polyunsaturated long-chain fatty acids. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced vitamin E-omega-hydroxylase activity and altered levels of tocopherols and their metabolites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik T A 9: 108,393,240 M1K probably null Het
2810021J22Rik T C 11: 58,880,340 L216S possibly damaging Het
4933405O20Rik G A 7: 50,599,472 E85K possibly damaging Het
Agrn A G 4: 156,173,035 F1153L probably damaging Het
Cbx8 A G 11: 119,038,916 S284P probably damaging Het
Cep128 A G 12: 91,339,119 L170P probably damaging Het
Daw1 G T 1: 83,192,698 V244L probably benign Het
Eef2kmt A G 16: 5,245,358 V306A probably benign Het
Enah A T 1: 181,935,728 probably null Het
Fam171b T C 2: 83,853,605 probably null Het
Fsip2 C T 2: 82,978,581 T1748I possibly damaging Het
Gabrg2 C T 11: 41,971,732 G175D probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hmcn1 G T 1: 150,582,296 N33K probably damaging Het
Incenp T A 19: 9,878,406 E514V unknown Het
Kank3 T C 17: 33,817,943 S74P probably benign Het
Lrriq1 G T 10: 103,215,345 N515K probably benign Het
Mfsd13b G A 7: 120,991,833 D266N probably damaging Het
Neto1 T C 18: 86,404,873 Y152H probably damaging Het
Nub1 C A 5: 24,695,535 F145L probably benign Het
Nufip1 T C 14: 76,114,275 probably null Het
Pard6g T A 18: 80,079,901 V50E probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Rapgef5 A C 12: 117,739,644 N431T probably damaging Het
Rassf9 A T 10: 102,545,344 T196S probably damaging Het
Rrp12 T C 19: 41,876,590 Y764C probably benign Het
Slfn8 T C 11: 83,017,724 probably null Het
Smox T A 2: 131,521,106 V265D probably damaging Het
Sult1b1 T C 5: 87,530,651 I105V probably benign Het
Sycp2 T C 2: 178,403,761 D22G probably damaging Het
Tbck G A 3: 132,751,216 M630I possibly damaging Het
Tenm4 G C 7: 96,837,331 G965R possibly damaging Het
Trappc10 G A 10: 78,187,860 T1258I probably damaging Het
Tssk1 G A 16: 17,895,259 G303S probably benign Het
Tstd2 T C 4: 46,120,461 Y313C probably damaging Het
Usp42 G A 5: 143,721,646 T260M probably damaging Het
Wdr43 T A 17: 71,648,777 V479E probably damaging Het
Xpo7 G A 14: 70,683,731 T599I probably damaging Het
Zfp553 A G 7: 127,236,841 K523E probably benign Het
Other mutations in Cyp4f14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Cyp4f14 APN 17 32914566 missense probably benign 0.06
IGL00858:Cyp4f14 APN 17 32911718 splice site probably benign
IGL01673:Cyp4f14 APN 17 32911151 splice site probably null
IGL01716:Cyp4f14 APN 17 32905496 utr 3 prime probably benign
IGL01768:Cyp4f14 APN 17 32908002 missense probably damaging 1.00
IGL02314:Cyp4f14 APN 17 32906291 missense probably benign 0.12
IGL02697:Cyp4f14 APN 17 32905623 missense probably damaging 0.97
IGL03035:Cyp4f14 APN 17 32914634 missense probably benign 0.15
dust UTSW 17 32916879 nonsense probably null
powder UTSW 17 32905509 missense probably benign 0.00
PIT4434001:Cyp4f14 UTSW 17 32906130 missense possibly damaging 0.94
R1186:Cyp4f14 UTSW 17 32916786 missense probably benign
R1230:Cyp4f14 UTSW 17 32916788 missense probably benign 0.00
R1671:Cyp4f14 UTSW 17 32916909 intron probably benign
R1672:Cyp4f14 UTSW 17 32909236 missense probably benign 0.00
R1696:Cyp4f14 UTSW 17 32909171 missense possibly damaging 0.81
R1828:Cyp4f14 UTSW 17 32911235 missense probably damaging 0.98
R1934:Cyp4f14 UTSW 17 32906315 missense probably damaging 1.00
R2023:Cyp4f14 UTSW 17 32906531 missense probably damaging 1.00
R3013:Cyp4f14 UTSW 17 32909165 missense probably benign 0.01
R3783:Cyp4f14 UTSW 17 32916762 missense probably benign 0.00
R4013:Cyp4f14 UTSW 17 32916879 nonsense probably null
R4369:Cyp4f14 UTSW 17 32909258 missense probably benign
R4371:Cyp4f14 UTSW 17 32909258 missense probably benign
R4683:Cyp4f14 UTSW 17 32908011 missense probably null 0.78
R5332:Cyp4f14 UTSW 17 32906091 missense probably benign 0.00
R5810:Cyp4f14 UTSW 17 32906098 missense possibly damaging 0.88
R6244:Cyp4f14 UTSW 17 32906317 missense probably benign 0.41
R6622:Cyp4f14 UTSW 17 32914645 missense probably benign
R6972:Cyp4f14 UTSW 17 32905509 missense probably benign 0.00
R6975:Cyp4f14 UTSW 17 32914634 missense probably benign 0.01
R7124:Cyp4f14 UTSW 17 32914588 missense probably benign 0.00
R7436:Cyp4f14 UTSW 17 32909157 missense probably benign 0.03
R7849:Cyp4f14 UTSW 17 32909351 missense probably benign 0.21
R8223:Cyp4f14 UTSW 17 32911653 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTCAGCACTGCATTGAGGAC -3'
(R):5'- TGACACAGGAGACAGGATACCC -3'

Sequencing Primer
(F):5'- CAGTGCCCAGGTAGTGAAATCC -3'
(R):5'- CAGTAAATTCAGACTGTACCAGTAGC -3'
Posted On2016-07-22