Incidental Mutation 'R5282:Rrp12'
ID402844
Institutional Source Beutler Lab
Gene Symbol Rrp12
Ensembl Gene ENSMUSG00000035049
Gene Nameribosomal RNA processing 12 homolog (S. cerevisiae)
Synonyms
MMRRC Submission 042867-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R5282 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location41862852-41896153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41876590 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 764 (Y764C)
Ref Sequence ENSEMBL: ENSMUSP00000039853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038677]
Predicted Effect probably benign
Transcript: ENSMUST00000038677
AA Change: Y764C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039853
Gene: ENSMUSG00000035049
AA Change: Y764C

DomainStartEndE-ValueType
low complexity region 164 175 N/A INTRINSIC
Pfam:NUC173 473 670 1.2e-72 PFAM
SCOP:d1qbkb_ 711 1087 2e-6 SMART
low complexity region 1157 1184 N/A INTRINSIC
low complexity region 1231 1243 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik T A 9: 108,393,240 M1K probably null Het
2810021J22Rik T C 11: 58,880,340 L216S possibly damaging Het
4933405O20Rik G A 7: 50,599,472 E85K possibly damaging Het
Agrn A G 4: 156,173,035 F1153L probably damaging Het
Cbx8 A G 11: 119,038,916 S284P probably damaging Het
Cep128 A G 12: 91,339,119 L170P probably damaging Het
Cyp4f14 T A 17: 32,907,985 T324S probably damaging Het
Daw1 G T 1: 83,192,698 V244L probably benign Het
Eef2kmt A G 16: 5,245,358 V306A probably benign Het
Enah A T 1: 181,935,728 probably null Het
Fam171b T C 2: 83,853,605 probably null Het
Fsip2 C T 2: 82,978,581 T1748I possibly damaging Het
Gabrg2 C T 11: 41,971,732 G175D probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hmcn1 G T 1: 150,582,296 N33K probably damaging Het
Incenp T A 19: 9,878,406 E514V unknown Het
Kank3 T C 17: 33,817,943 S74P probably benign Het
Lrriq1 G T 10: 103,215,345 N515K probably benign Het
Mfsd13b G A 7: 120,991,833 D266N probably damaging Het
Neto1 T C 18: 86,404,873 Y152H probably damaging Het
Nub1 C A 5: 24,695,535 F145L probably benign Het
Nufip1 T C 14: 76,114,275 probably null Het
Pard6g T A 18: 80,079,901 V50E probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Rapgef5 A C 12: 117,739,644 N431T probably damaging Het
Rassf9 A T 10: 102,545,344 T196S probably damaging Het
Slfn8 T C 11: 83,017,724 probably null Het
Smox T A 2: 131,521,106 V265D probably damaging Het
Sult1b1 T C 5: 87,530,651 I105V probably benign Het
Sycp2 T C 2: 178,403,761 D22G probably damaging Het
Tbck G A 3: 132,751,216 M630I possibly damaging Het
Tenm4 G C 7: 96,837,331 G965R possibly damaging Het
Trappc10 G A 10: 78,187,860 T1258I probably damaging Het
Tssk1 G A 16: 17,895,259 G303S probably benign Het
Tstd2 T C 4: 46,120,461 Y313C probably damaging Het
Usp42 G A 5: 143,721,646 T260M probably damaging Het
Wdr43 T A 17: 71,648,777 V479E probably damaging Het
Xpo7 G A 14: 70,683,731 T599I probably damaging Het
Zfp553 A G 7: 127,236,841 K523E probably benign Het
Other mutations in Rrp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Rrp12 APN 19 41887094 missense possibly damaging 0.94
IGL00430:Rrp12 APN 19 41877334 critical splice donor site probably null
IGL00496:Rrp12 APN 19 41878027 critical splice donor site probably null
IGL00953:Rrp12 APN 19 41871792 missense possibly damaging 0.51
IGL01320:Rrp12 APN 19 41877936 missense probably damaging 1.00
IGL01479:Rrp12 APN 19 41865202 missense probably benign 0.05
IGL01939:Rrp12 APN 19 41870895 missense probably damaging 0.99
IGL02147:Rrp12 APN 19 41886181 missense probably damaging 1.00
IGL02255:Rrp12 APN 19 41872971 missense probably damaging 1.00
IGL02756:Rrp12 APN 19 41896061 missense probably benign 0.03
IGL02793:Rrp12 APN 19 41871566 missense probably damaging 1.00
IGL03026:Rrp12 APN 19 41872997 missense probably damaging 1.00
IGL03202:Rrp12 APN 19 41868766 splice site probably null
IGL03393:Rrp12 APN 19 41871793 missense possibly damaging 0.91
R0137:Rrp12 UTSW 19 41873850 missense probably benign
R0234:Rrp12 UTSW 19 41871760 missense probably damaging 1.00
R0234:Rrp12 UTSW 19 41871760 missense probably damaging 1.00
R0522:Rrp12 UTSW 19 41874705 splice site probably benign
R0616:Rrp12 UTSW 19 41892549 missense possibly damaging 0.95
R1509:Rrp12 UTSW 19 41882200 missense probably damaging 1.00
R1537:Rrp12 UTSW 19 41886803 missense probably damaging 0.97
R1593:Rrp12 UTSW 19 41863241 missense probably benign 0.00
R1635:Rrp12 UTSW 19 41868785 missense probably benign 0.00
R1642:Rrp12 UTSW 19 41871737 missense probably damaging 1.00
R1696:Rrp12 UTSW 19 41873749 missense probably damaging 1.00
R1827:Rrp12 UTSW 19 41880481 missense possibly damaging 0.95
R1844:Rrp12 UTSW 19 41877783 critical splice donor site probably null
R1950:Rrp12 UTSW 19 41892590 missense probably damaging 1.00
R2010:Rrp12 UTSW 19 41872937 missense probably benign
R2115:Rrp12 UTSW 19 41891094 missense probably benign 0.38
R2136:Rrp12 UTSW 19 41892599 missense probably damaging 1.00
R2386:Rrp12 UTSW 19 41871284 missense probably benign 0.41
R3741:Rrp12 UTSW 19 41885728 missense probably damaging 1.00
R4096:Rrp12 UTSW 19 41887148 missense probably benign 0.32
R4292:Rrp12 UTSW 19 41872905 splice site probably null
R4407:Rrp12 UTSW 19 41892551 missense probably damaging 1.00
R4629:Rrp12 UTSW 19 41883516 missense probably benign 0.03
R4698:Rrp12 UTSW 19 41873042 missense probably benign 0.12
R4702:Rrp12 UTSW 19 41871536 missense probably damaging 1.00
R4716:Rrp12 UTSW 19 41877428 missense probably damaging 1.00
R4837:Rrp12 UTSW 19 41877505 splice site probably null
R5327:Rrp12 UTSW 19 41892596 missense probably damaging 1.00
R5621:Rrp12 UTSW 19 41880417 missense probably benign
R5762:Rrp12 UTSW 19 41880152 missense possibly damaging 0.88
R5947:Rrp12 UTSW 19 41870808 critical splice donor site probably null
R6213:Rrp12 UTSW 19 41868778 missense probably benign
R6407:Rrp12 UTSW 19 41883742 missense probably damaging 0.98
R6980:Rrp12 UTSW 19 41890143 missense probably damaging 0.98
R7179:Rrp12 UTSW 19 41883778 missense probably benign 0.03
R7186:Rrp12 UTSW 19 41871305 critical splice acceptor site probably null
R7194:Rrp12 UTSW 19 41871540 missense probably benign
R7206:Rrp12 UTSW 19 41878039 missense probably damaging 1.00
R7209:Rrp12 UTSW 19 41872949 missense possibly damaging 0.62
R7248:Rrp12 UTSW 19 41883438 missense possibly damaging 0.82
R7976:Rrp12 UTSW 19 41891109 missense probably benign 0.04
R8075:Rrp12 UTSW 19 41863274 missense probably damaging 0.96
R8322:Rrp12 UTSW 19 41880219 missense probably benign 0.09
Z1177:Rrp12 UTSW 19 41865567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGAAAAGAGTGTAGCCTTTGTTC -3'
(R):5'- AGTAGCGCTACCTTCCTTGC -3'

Sequencing Primer
(F):5'- TGTTCTACAAGACACACCTTGG -3'
(R):5'- GCTTACCATTCGCAAATGCC -3'
Posted On2016-07-22