Incidental Mutation 'R5283:Fnip2'
ID402860
Institutional Source Beutler Lab
Gene Symbol Fnip2
Ensembl Gene ENSMUSG00000061175
Gene Namefolliculin interacting protein 2
SynonymsD630023B12Rik
MMRRC Submission 042868-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5283 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location79455974-79567796 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79465708 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1021 (I1021N)
Ref Sequence ENSEMBL: ENSMUSP00000115275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076136] [ENSMUST00000133154] [ENSMUST00000164216]
Predicted Effect probably damaging
Transcript: ENSMUST00000076136
AA Change: I991N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075497
Gene: ENSMUSG00000061175
AA Change: I991N

DomainStartEndE-ValueType
Pfam:FNIP_N 42 168 4.3e-39 PFAM
low complexity region 240 261 N/A INTRINSIC
Pfam:FNIP_M 289 528 5.9e-92 PFAM
low complexity region 557 571 N/A INTRINSIC
low complexity region 748 755 N/A INTRINSIC
Pfam:FNIP_C 920 1104 4.1e-73 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133154
AA Change: I1021N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115275
Gene: ENSMUSG00000061175
AA Change: I1021N

DomainStartEndE-ValueType
Pfam:FNIP_N 42 164 5.2e-34 PFAM
low complexity region 270 291 N/A INTRINSIC
Pfam:FNIP_M 323 557 3.9e-93 PFAM
low complexity region 587 601 N/A INTRINSIC
low complexity region 778 785 N/A INTRINSIC
Pfam:FNIP_C 951 1134 2.3e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149475
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154645
Predicted Effect probably benign
Transcript: ENSMUST00000164216
SMART Domains Protein: ENSMUSP00000130702
Gene: ENSMUSG00000091685

DomainStartEndE-ValueType
Pfam:DUF4562 18 132 1.1e-59 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the folliculin-interacting protein family. The encoded protein binds to the tumor suppressor folliculin and to AMP-activated protein kinase (AMPK) and be involved in regulating the O6-methylguanine-induced apoptosis signaling pathway. This protein may also play a role cellular metabolism and nutrient sensing by regulating the AMPK-mechanistic target of rapamycin signaling pathway. A homologous binding partner of this protein, folliculin-interacting protein 1, has similar binding activities and may suggest functional redundancy within this protein family. Both folliculin-interacting proteins have also been shown to bind the molecular chaperone heat shock protein-90 (Hsp90) and they may function as a co-chaperones in the stabilization of tumor suppressor folliculin which is a target of Hsp90 chaperone activity. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele have normal lifespans. Mice with combined loss of this gene and a single null allele of Fnip1 develop kidney cancer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik C T 1: 93,159,853 D93N probably benign Het
Aamp C T 1: 74,284,006 E53K possibly damaging Het
Amotl1 T C 9: 14,558,484 E651G probably damaging Het
Ankrd11 A C 8: 122,884,182 V2655G probably damaging Het
Apbb1ip G A 2: 22,867,671 V434M probably benign Het
Atp5h T C 11: 115,415,785 Y150C probably damaging Het
BC117090 T C 16: 36,321,843 D57G probably damaging Het
Ccdc13 T A 9: 121,808,188 D75V probably damaging Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Crh T C 3: 19,694,007 H157R probably damaging Het
Dpp4 G A 2: 62,360,336 T392I probably damaging Het
Ehd3 G T 17: 73,820,503 A144S probably benign Het
Fus T A 7: 127,985,547 probably benign Het
Glo1 T C 17: 30,600,073 T92A probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm15130 A C 2: 111,135,409 M165R unknown Het
Gm9573 A G 17: 35,621,332 probably benign Het
Gon4l T C 3: 88,887,590 L700P probably damaging Het
Grm1 C A 10: 10,733,192 D566Y possibly damaging Het
Guca1b T C 17: 47,391,270 probably benign Het
Has3 A G 8: 106,874,115 M70V probably damaging Het
Hydin G T 8: 110,451,980 C1069F possibly damaging Het
Ints1 A C 5: 139,764,382 L920R probably damaging Het
Kdm2a T C 19: 4,331,269 I54V probably benign Het
Kpna2 G A 11: 106,990,832 T324I probably damaging Het
Lrr1 T C 12: 69,174,654 L190S probably damaging Het
Lrrc49 A T 9: 60,687,178 H16Q probably benign Het
Mapkap1 A G 2: 34,444,348 E147G probably damaging Het
Mrpl2 C T 17: 46,649,066 R219W possibly damaging Het
Ndc80 A G 17: 71,521,135 S66P probably benign Het
Notch1 A G 2: 26,468,626 Y1398H probably damaging Het
Olfml2b C T 1: 170,681,189 R539* probably null Het
Olfr6 T A 7: 106,956,748 T63S probably benign Het
Pde7a T C 3: 19,260,256 T59A probably damaging Het
Plekhg1 G A 10: 3,956,654 V524I probably benign Het
Plin4 T A 17: 56,106,777 M283L probably benign Het
Prp2 C T 6: 132,600,643 P298S unknown Het
Rap1gap2 G A 11: 74,395,825 R550C probably damaging Het
Reln G A 5: 22,011,163 T1008I probably damaging Het
Rffl T C 11: 82,812,789 K103E probably damaging Het
Rmnd5b A T 11: 51,627,060 F156I probably damaging Het
Rtn4ip1 T C 10: 43,902,465 I68T probably damaging Het
Samhd1 T C 2: 157,109,492 I442V possibly damaging Het
Slc12a4 A T 8: 105,950,694 probably null Het
Slc35b1 G T 11: 95,384,988 probably benign Het
Ssh1 A G 5: 113,950,545 V354A probably damaging Het
Stk33 T C 7: 109,336,127 K153E possibly damaging Het
Stk4 C T 2: 164,110,279 R19* probably null Het
Tas2r136 A T 6: 132,777,411 I251N probably damaging Het
Tbr1 A T 2: 61,804,900 T65S probably benign Het
Tkt C T 14: 30,560,618 S124F probably damaging Het
Tll1 T C 8: 64,101,966 I228V possibly damaging Het
Tmem236 A G 2: 14,174,833 I82V probably benign Het
Vmn2r110 T C 17: 20,580,637 Q511R probably benign Het
Vmn2r98 T C 17: 19,080,719 M661T probably benign Het
Vps13a T A 19: 16,677,970 K1898I probably damaging Het
Zc3h12a T C 4: 125,126,765 E95G probably benign Het
Other mutations in Fnip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Fnip2 APN 3 79481521 missense probably benign
IGL00339:Fnip2 APN 3 79515155 missense probably benign 0.12
IGL00340:Fnip2 APN 3 79518061 splice site probably benign
IGL00434:Fnip2 APN 3 79512489 splice site probably benign
IGL01134:Fnip2 APN 3 79512503 nonsense probably null
IGL02732:Fnip2 APN 3 79465697 missense probably damaging 1.00
IGL03327:Fnip2 APN 3 79518081 missense probably damaging 0.98
IGL03402:Fnip2 APN 3 79481276 missense possibly damaging 0.92
R0314:Fnip2 UTSW 3 79481189 missense probably damaging 1.00
R0318:Fnip2 UTSW 3 79512378 missense probably damaging 1.00
R0699:Fnip2 UTSW 3 79481139 missense probably benign 0.00
R1188:Fnip2 UTSW 3 79462162 missense probably damaging 1.00
R1290:Fnip2 UTSW 3 79465693 missense probably damaging 1.00
R1406:Fnip2 UTSW 3 79508091 missense possibly damaging 0.85
R1406:Fnip2 UTSW 3 79508091 missense possibly damaging 0.85
R1535:Fnip2 UTSW 3 79481765 missense probably damaging 1.00
R1618:Fnip2 UTSW 3 79508168 missense possibly damaging 0.70
R1661:Fnip2 UTSW 3 79515149 missense probably benign
R1665:Fnip2 UTSW 3 79515149 missense probably benign
R1965:Fnip2 UTSW 3 79493472 missense probably benign 0.31
R1966:Fnip2 UTSW 3 79493472 missense probably benign 0.31
R1976:Fnip2 UTSW 3 79480931 missense probably benign 0.02
R2004:Fnip2 UTSW 3 79512325 splice site probably benign
R2054:Fnip2 UTSW 3 79572465 unclassified probably benign
R2145:Fnip2 UTSW 3 79500432 missense probably damaging 0.99
R2400:Fnip2 UTSW 3 79479634 missense probably benign 0.03
R2679:Fnip2 UTSW 3 79480926 missense probably benign 0.13
R3157:Fnip2 UTSW 3 79567594 missense probably damaging 1.00
R3851:Fnip2 UTSW 3 79462157 missense probably damaging 1.00
R3910:Fnip2 UTSW 3 79479505 missense possibly damaging 0.83
R3911:Fnip2 UTSW 3 79479505 missense possibly damaging 0.83
R3912:Fnip2 UTSW 3 79479505 missense possibly damaging 0.83
R4035:Fnip2 UTSW 3 79479501 missense probably benign 0.00
R4166:Fnip2 UTSW 3 79462135 missense probably damaging 1.00
R4537:Fnip2 UTSW 3 79465714 missense probably damaging 0.98
R4732:Fnip2 UTSW 3 79481652 missense probably damaging 1.00
R4733:Fnip2 UTSW 3 79481652 missense probably damaging 1.00
R4774:Fnip2 UTSW 3 79465721 nonsense probably null
R4923:Fnip2 UTSW 3 79489394 critical splice acceptor site probably null
R5043:Fnip2 UTSW 3 79492867 nonsense probably null
R5160:Fnip2 UTSW 3 79488991 missense probably damaging 1.00
R5162:Fnip2 UTSW 3 79481777 missense probably damaging 1.00
R5196:Fnip2 UTSW 3 79572538 unclassified probably benign
R5364:Fnip2 UTSW 3 79481168 missense probably benign 0.00
R5402:Fnip2 UTSW 3 79480943 missense possibly damaging 0.89
R6340:Fnip2 UTSW 3 79507845 missense probably damaging 1.00
R6459:Fnip2 UTSW 3 79481634 missense possibly damaging 0.93
R6592:Fnip2 UTSW 3 79481708 missense probably benign 0.26
R6616:Fnip2 UTSW 3 79480882 missense probably benign 0.00
R6933:Fnip2 UTSW 3 79518111 missense probably benign 0.28
R6962:Fnip2 UTSW 3 79489303 missense probably damaging 1.00
R6971:Fnip2 UTSW 3 79481121 nonsense probably null
R7050:Fnip2 UTSW 3 79506270 missense probably damaging 0.99
R7097:Fnip2 UTSW 3 79481006 missense probably benign
R7315:Fnip2 UTSW 3 79506205 critical splice donor site probably null
R7714:Fnip2 UTSW 3 79518114 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACACTGTCAAAGCTCTGCC -3'
(R):5'- TGGCACACCTTCCTGAGTAC -3'

Sequencing Primer
(F):5'- TGATGACAGAAGATCAGACACTTAC -3'
(R):5'- TGAGTACCTGTAACACTCCATG -3'
Posted On2016-07-22