Incidental Mutation 'R5283:Has3'
ID402877
Institutional Source Beutler Lab
Gene Symbol Has3
Ensembl Gene ENSMUSG00000031910
Gene Namehyaluronan synthase 3
Synonyms
MMRRC Submission 042868-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5283 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location106870242-106884566 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106874115 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 70 (M70V)
Ref Sequence ENSEMBL: ENSMUSP00000135596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034385] [ENSMUST00000175987] [ENSMUST00000176144]
Predicted Effect probably benign
Transcript: ENSMUST00000034385
AA Change: M70V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000034385
Gene: ENSMUSG00000031910
AA Change: M70V

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 42 64 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 85 361 4e-22 PFAM
Pfam:Glycos_transf_2 183 300 4.5e-7 PFAM
Pfam:Glyco_transf_21 188 360 5.7e-8 PFAM
Pfam:Chitin_synth_2 198 451 7.7e-17 PFAM
Pfam:Glyco_trans_2_3 211 538 1.7e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000175987
AA Change: M70V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135596
Gene: ENSMUSG00000031910
AA Change: M70V

DomainStartEndE-ValueType
transmembrane domain 11 33 N/A INTRINSIC
transmembrane domain 43 65 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 85 251 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176144
AA Change: M70V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000135303
Gene: ENSMUSG00000031910
AA Change: M70V

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 42 64 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 85 361 4.5e-24 PFAM
Pfam:Glyco_transf_21 189 360 7e-8 PFAM
Pfam:Chitin_synth_2 197 457 3.2e-16 PFAM
Pfam:Glyco_trans_2_3 211 537 5e-12 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the synthesis of the unbranched glycosaminoglycan hyaluronan, or hyaluronic acid, which is a major constituent of the extracellular matrix. This gene is a member of the NODC/HAS gene family. Compared to the proteins encoded by other members of this gene family, this protein appears to be more of a regulator of hyaluronan synthesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a null allele are viable and fertile with normal static and dynamic compliances and display a reduced high tidal volume ventilation-induced inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik C T 1: 93,159,853 D93N probably benign Het
Aamp C T 1: 74,284,006 E53K possibly damaging Het
Amotl1 T C 9: 14,558,484 E651G probably damaging Het
Ankrd11 A C 8: 122,884,182 V2655G probably damaging Het
Apbb1ip G A 2: 22,867,671 V434M probably benign Het
Atp5h T C 11: 115,415,785 Y150C probably damaging Het
BC117090 T C 16: 36,321,843 D57G probably damaging Het
Ccdc13 T A 9: 121,808,188 D75V probably damaging Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Crh T C 3: 19,694,007 H157R probably damaging Het
Dpp4 G A 2: 62,360,336 T392I probably damaging Het
Ehd3 G T 17: 73,820,503 A144S probably benign Het
Fnip2 A T 3: 79,465,708 I1021N probably damaging Het
Fus T A 7: 127,985,547 probably benign Het
Glo1 T C 17: 30,600,073 T92A probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm15130 A C 2: 111,135,409 M165R unknown Het
Gm9573 A G 17: 35,621,332 probably benign Het
Gon4l T C 3: 88,887,590 L700P probably damaging Het
Grm1 C A 10: 10,733,192 D566Y possibly damaging Het
Guca1b T C 17: 47,391,270 probably benign Het
Hydin G T 8: 110,451,980 C1069F possibly damaging Het
Ints1 A C 5: 139,764,382 L920R probably damaging Het
Kdm2a T C 19: 4,331,269 I54V probably benign Het
Kpna2 G A 11: 106,990,832 T324I probably damaging Het
Lrr1 T C 12: 69,174,654 L190S probably damaging Het
Lrrc49 A T 9: 60,687,178 H16Q probably benign Het
Mapkap1 A G 2: 34,444,348 E147G probably damaging Het
Mrpl2 C T 17: 46,649,066 R219W possibly damaging Het
Ndc80 A G 17: 71,521,135 S66P probably benign Het
Notch1 A G 2: 26,468,626 Y1398H probably damaging Het
Olfml2b C T 1: 170,681,189 R539* probably null Het
Olfr6 T A 7: 106,956,748 T63S probably benign Het
Pde7a T C 3: 19,260,256 T59A probably damaging Het
Plekhg1 G A 10: 3,956,654 V524I probably benign Het
Plin4 T A 17: 56,106,777 M283L probably benign Het
Prp2 C T 6: 132,600,643 P298S unknown Het
Rap1gap2 G A 11: 74,395,825 R550C probably damaging Het
Reln G A 5: 22,011,163 T1008I probably damaging Het
Rffl T C 11: 82,812,789 K103E probably damaging Het
Rmnd5b A T 11: 51,627,060 F156I probably damaging Het
Rtn4ip1 T C 10: 43,902,465 I68T probably damaging Het
Samhd1 T C 2: 157,109,492 I442V possibly damaging Het
Slc12a4 A T 8: 105,950,694 probably null Het
Slc35b1 G T 11: 95,384,988 probably benign Het
Ssh1 A G 5: 113,950,545 V354A probably damaging Het
Stk33 T C 7: 109,336,127 K153E possibly damaging Het
Stk4 C T 2: 164,110,279 R19* probably null Het
Tas2r136 A T 6: 132,777,411 I251N probably damaging Het
Tbr1 A T 2: 61,804,900 T65S probably benign Het
Tkt C T 14: 30,560,618 S124F probably damaging Het
Tll1 T C 8: 64,101,966 I228V possibly damaging Het
Tmem236 A G 2: 14,174,833 I82V probably benign Het
Vmn2r110 T C 17: 20,580,637 Q511R probably benign Het
Vmn2r98 T C 17: 19,080,719 M661T probably benign Het
Vps13a T A 19: 16,677,970 K1898I probably damaging Het
Zc3h12a T C 4: 125,126,765 E95G probably benign Het
Other mutations in Has3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Has3 APN 8 106878599 missense probably benign 0.14
IGL01115:Has3 APN 8 106878688 missense probably benign 0.01
IGL01565:Has3 APN 8 106874445 missense probably benign
IGL02341:Has3 APN 8 106874005 missense probably damaging 1.00
IGL03026:Has3 APN 8 106878610 missense probably benign 0.02
R1852:Has3 UTSW 8 106874079 missense probably damaging 0.98
R1956:Has3 UTSW 8 106878803 missense probably benign 0.00
R1958:Has3 UTSW 8 106878803 missense probably benign 0.00
R2256:Has3 UTSW 8 106874256 missense probably damaging 1.00
R4296:Has3 UTSW 8 106878422 missense possibly damaging 0.90
R4726:Has3 UTSW 8 106878086 missense probably damaging 1.00
R5526:Has3 UTSW 8 106873947 missense probably damaging 1.00
Z1177:Has3 UTSW 8 106874018 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGTCTGTTTGCCCTGGTAG -3'
(R):5'- AAGAAGCCAGCTTGCTCAGTG -3'

Sequencing Primer
(F):5'- TAGTGCTGGGAGGCATCC -3'
(R):5'- CAACATGTAGGTATCTTCCTGGCG -3'
Posted On2016-07-22