Incidental Mutation 'R5283:Ccdc13'
ID402882
Institutional Source Beutler Lab
Gene Symbol Ccdc13
Ensembl Gene ENSMUSG00000079235
Gene Namecoiled-coil domain containing 13
Synonyms
MMRRC Submission 042868-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R5283 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location121797627-121839461 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121808188 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 75 (D75V)
Ref Sequence ENSEMBL: ENSMUSP00000130887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000135986] [ENSMUST00000142783] [ENSMUST00000155511]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126851
Predicted Effect probably damaging
Transcript: ENSMUST00000135986
AA Change: D557V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114787
Gene: ENSMUSG00000079235
AA Change: D557V

DomainStartEndE-ValueType
coiled coil region 19 46 N/A INTRINSIC
coiled coil region 70 103 N/A INTRINSIC
coiled coil region 139 178 N/A INTRINSIC
coiled coil region 206 248 N/A INTRINSIC
low complexity region 293 304 N/A INTRINSIC
coiled coil region 323 370 N/A INTRINSIC
coiled coil region 428 458 N/A INTRINSIC
coiled coil region 550 604 N/A INTRINSIC
coiled coil region 648 670 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140929
Predicted Effect probably damaging
Transcript: ENSMUST00000142783
AA Change: D75V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130887
Gene: ENSMUSG00000079235
AA Change: D75V

DomainStartEndE-ValueType
coiled coil region 68 122 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155511
AA Change: D81V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik C T 1: 93,159,853 D93N probably benign Het
Aamp C T 1: 74,284,006 E53K possibly damaging Het
Amotl1 T C 9: 14,558,484 E651G probably damaging Het
Ankrd11 A C 8: 122,884,182 V2655G probably damaging Het
Apbb1ip G A 2: 22,867,671 V434M probably benign Het
Atp5h T C 11: 115,415,785 Y150C probably damaging Het
BC117090 T C 16: 36,321,843 D57G probably damaging Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Crh T C 3: 19,694,007 H157R probably damaging Het
Dpp4 G A 2: 62,360,336 T392I probably damaging Het
Ehd3 G T 17: 73,820,503 A144S probably benign Het
Fnip2 A T 3: 79,465,708 I1021N probably damaging Het
Fus T A 7: 127,985,547 probably benign Het
Glo1 T C 17: 30,600,073 T92A probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm15130 A C 2: 111,135,409 M165R unknown Het
Gm9573 A G 17: 35,621,332 probably benign Het
Gon4l T C 3: 88,887,590 L700P probably damaging Het
Grm1 C A 10: 10,733,192 D566Y possibly damaging Het
Guca1b T C 17: 47,391,270 probably benign Het
Has3 A G 8: 106,874,115 M70V probably damaging Het
Hydin G T 8: 110,451,980 C1069F possibly damaging Het
Ints1 A C 5: 139,764,382 L920R probably damaging Het
Kdm2a T C 19: 4,331,269 I54V probably benign Het
Kpna2 G A 11: 106,990,832 T324I probably damaging Het
Lrr1 T C 12: 69,174,654 L190S probably damaging Het
Lrrc49 A T 9: 60,687,178 H16Q probably benign Het
Mapkap1 A G 2: 34,444,348 E147G probably damaging Het
Mrpl2 C T 17: 46,649,066 R219W possibly damaging Het
Ndc80 A G 17: 71,521,135 S66P probably benign Het
Notch1 A G 2: 26,468,626 Y1398H probably damaging Het
Olfml2b C T 1: 170,681,189 R539* probably null Het
Olfr6 T A 7: 106,956,748 T63S probably benign Het
Pde7a T C 3: 19,260,256 T59A probably damaging Het
Plekhg1 G A 10: 3,956,654 V524I probably benign Het
Plin4 T A 17: 56,106,777 M283L probably benign Het
Prp2 C T 6: 132,600,643 P298S unknown Het
Rap1gap2 G A 11: 74,395,825 R550C probably damaging Het
Reln G A 5: 22,011,163 T1008I probably damaging Het
Rffl T C 11: 82,812,789 K103E probably damaging Het
Rmnd5b A T 11: 51,627,060 F156I probably damaging Het
Rtn4ip1 T C 10: 43,902,465 I68T probably damaging Het
Samhd1 T C 2: 157,109,492 I442V possibly damaging Het
Slc12a4 A T 8: 105,950,694 probably null Het
Slc35b1 G T 11: 95,384,988 probably benign Het
Ssh1 A G 5: 113,950,545 V354A probably damaging Het
Stk33 T C 7: 109,336,127 K153E possibly damaging Het
Stk4 C T 2: 164,110,279 R19* probably null Het
Tas2r136 A T 6: 132,777,411 I251N probably damaging Het
Tbr1 A T 2: 61,804,900 T65S probably benign Het
Tkt C T 14: 30,560,618 S124F probably damaging Het
Tll1 T C 8: 64,101,966 I228V possibly damaging Het
Tmem236 A G 2: 14,174,833 I82V probably benign Het
Vmn2r110 T C 17: 20,580,637 Q511R probably benign Het
Vmn2r98 T C 17: 19,080,719 M661T probably benign Het
Vps13a T A 19: 16,677,970 K1898I probably damaging Het
Zc3h12a T C 4: 125,126,765 E95G probably benign Het
Other mutations in Ccdc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Ccdc13 APN 9 121810084 splice site probably benign
IGL01306:Ccdc13 APN 9 121827363 missense probably benign 0.37
ANU23:Ccdc13 UTSW 9 121827363 missense probably benign 0.37
R0112:Ccdc13 UTSW 9 121813481 missense probably damaging 0.98
R0144:Ccdc13 UTSW 9 121827351 missense probably damaging 0.98
R0360:Ccdc13 UTSW 9 121798216 missense probably damaging 1.00
R0364:Ccdc13 UTSW 9 121798216 missense probably damaging 1.00
R1441:Ccdc13 UTSW 9 121813449 missense probably benign 0.44
R1674:Ccdc13 UTSW 9 121809142 missense probably damaging 1.00
R1691:Ccdc13 UTSW 9 121825068 splice site probably null
R1710:Ccdc13 UTSW 9 121819581 missense probably damaging 1.00
R3821:Ccdc13 UTSW 9 121831019 missense probably damaging 1.00
R3822:Ccdc13 UTSW 9 121831019 missense probably damaging 1.00
R3962:Ccdc13 UTSW 9 121798939 intron probably benign
R4695:Ccdc13 UTSW 9 121820760 missense probably damaging 1.00
R4758:Ccdc13 UTSW 9 121833734 missense possibly damaging 0.91
R5058:Ccdc13 UTSW 9 121817547 intron probably benign
R5436:Ccdc13 UTSW 9 121799043 missense probably benign 0.06
R5601:Ccdc13 UTSW 9 121800572 nonsense probably null
R5623:Ccdc13 UTSW 9 121833733 missense probably damaging 0.99
R5653:Ccdc13 UTSW 9 121798787 makesense probably null
R5665:Ccdc13 UTSW 9 121814290 missense probably damaging 0.99
R5975:Ccdc13 UTSW 9 121827235 missense probably benign 0.00
R6212:Ccdc13 UTSW 9 121798909 intron probably benign
R6213:Ccdc13 UTSW 9 121798909 intron probably benign
R6214:Ccdc13 UTSW 9 121798909 intron probably benign
R6215:Ccdc13 UTSW 9 121798909 intron probably benign
R6222:Ccdc13 UTSW 9 121798909 intron probably benign
R6223:Ccdc13 UTSW 9 121798909 intron probably benign
R6257:Ccdc13 UTSW 9 121798909 intron probably benign
R7053:Ccdc13 UTSW 9 121833838 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGAAGATGGTTACATTTGACAGAGC -3'
(R):5'- ACCTCTGAGTTTCCCAGTGC -3'

Sequencing Primer
(F):5'- AATCTCCTTGAATTTGCCTGAGTG -3'
(R):5'- AGTGCCTCCTGCCATTGTATG -3'
Posted On2016-07-22