Incidental Mutation 'R5283:Vmn2r98'
ID402896
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Namevomeronasal 2, receptor 98
SynonymsEG224552
MMRRC Submission 042868-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R5283 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location19053460-19082411 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19080719 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 661 (M661T)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
Predicted Effect probably benign
Transcript: ENSMUST00000170424
AA Change: M661T

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: M661T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik C T 1: 93,159,853 D93N probably benign Het
Aamp C T 1: 74,284,006 E53K possibly damaging Het
Amotl1 T C 9: 14,558,484 E651G probably damaging Het
Ankrd11 A C 8: 122,884,182 V2655G probably damaging Het
Apbb1ip G A 2: 22,867,671 V434M probably benign Het
Atp5h T C 11: 115,415,785 Y150C probably damaging Het
BC117090 T C 16: 36,321,843 D57G probably damaging Het
Ccdc13 T A 9: 121,808,188 D75V probably damaging Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Crh T C 3: 19,694,007 H157R probably damaging Het
Dpp4 G A 2: 62,360,336 T392I probably damaging Het
Ehd3 G T 17: 73,820,503 A144S probably benign Het
Fnip2 A T 3: 79,465,708 I1021N probably damaging Het
Fus T A 7: 127,985,547 probably benign Het
Glo1 T C 17: 30,600,073 T92A probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm15130 A C 2: 111,135,409 M165R unknown Het
Gm9573 A G 17: 35,621,332 probably benign Het
Gon4l T C 3: 88,887,590 L700P probably damaging Het
Grm1 C A 10: 10,733,192 D566Y possibly damaging Het
Guca1b T C 17: 47,391,270 probably benign Het
Has3 A G 8: 106,874,115 M70V probably damaging Het
Hydin G T 8: 110,451,980 C1069F possibly damaging Het
Ints1 A C 5: 139,764,382 L920R probably damaging Het
Kdm2a T C 19: 4,331,269 I54V probably benign Het
Kpna2 G A 11: 106,990,832 T324I probably damaging Het
Lrr1 T C 12: 69,174,654 L190S probably damaging Het
Lrrc49 A T 9: 60,687,178 H16Q probably benign Het
Mapkap1 A G 2: 34,444,348 E147G probably damaging Het
Mrpl2 C T 17: 46,649,066 R219W possibly damaging Het
Ndc80 A G 17: 71,521,135 S66P probably benign Het
Notch1 A G 2: 26,468,626 Y1398H probably damaging Het
Olfml2b C T 1: 170,681,189 R539* probably null Het
Olfr6 T A 7: 106,956,748 T63S probably benign Het
Pde7a T C 3: 19,260,256 T59A probably damaging Het
Plekhg1 G A 10: 3,956,654 V524I probably benign Het
Plin4 T A 17: 56,106,777 M283L probably benign Het
Prp2 C T 6: 132,600,643 P298S unknown Het
Rap1gap2 G A 11: 74,395,825 R550C probably damaging Het
Reln G A 5: 22,011,163 T1008I probably damaging Het
Rffl T C 11: 82,812,789 K103E probably damaging Het
Rmnd5b A T 11: 51,627,060 F156I probably damaging Het
Rtn4ip1 T C 10: 43,902,465 I68T probably damaging Het
Samhd1 T C 2: 157,109,492 I442V possibly damaging Het
Slc12a4 A T 8: 105,950,694 probably null Het
Slc35b1 G T 11: 95,384,988 probably benign Het
Ssh1 A G 5: 113,950,545 V354A probably damaging Het
Stk33 T C 7: 109,336,127 K153E possibly damaging Het
Stk4 C T 2: 164,110,279 R19* probably null Het
Tas2r136 A T 6: 132,777,411 I251N probably damaging Het
Tbr1 A T 2: 61,804,900 T65S probably benign Het
Tkt C T 14: 30,560,618 S124F probably damaging Het
Tll1 T C 8: 64,101,966 I228V possibly damaging Het
Tmem236 A G 2: 14,174,833 I82V probably benign Het
Vmn2r110 T C 17: 20,580,637 Q511R probably benign Het
Vps13a T A 19: 16,677,970 K1898I probably damaging Het
Zc3h12a T C 4: 125,126,765 E95G probably benign Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19065745 splice site probably benign
IGL01296:Vmn2r98 APN 17 19065185 missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19065758 missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19065259 missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19066451 missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19066286 missense probably benign
IGL02123:Vmn2r98 APN 17 19080679 missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19065851 missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19065821 missense probably benign
IGL02650:Vmn2r98 APN 17 19080961 missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19065259 missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19066013 missense probably benign
IGL02807:Vmn2r98 APN 17 19081021 missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19065980 missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19069845 missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19080961 missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19066400 missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19065827 nonsense probably null
R0545:Vmn2r98 UTSW 17 19053613 missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19080497 missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19080520 missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19080749 missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19065948 missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19065178 missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19080908 missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19066440 missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19066418 missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19065333 nonsense probably null
R2165:Vmn2r98 UTSW 17 19081291 missense unknown
R2238:Vmn2r98 UTSW 17 19065951 missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19080436 missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19065819 missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19081177 missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19067402 missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19080625 missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19066092 missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19069745 missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19066340 missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19066157 missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19066044 missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19053553 missense probably benign 0.13
R5294:Vmn2r98 UTSW 17 19069754 nonsense probably null
R5371:Vmn2r98 UTSW 17 19069753 missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19080899 missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19065998 missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19066074 missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19065881 missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19065801 missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19065248 missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19066268 missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19080922 missense probably benign
R7068:Vmn2r98 UTSW 17 19065313 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCATCTTTGTGAAGCACAGAG -3'
(R):5'- TGCACAAAATGAGGATGTGTCC -3'

Sequencing Primer
(F):5'- TGTGAAGCACAGAGACACTCCTATTG -3'
(R):5'- GTCCATATTCAGTATGAGCATCTTGG -3'
Posted On2016-07-22