Incidental Mutation 'R5284:Klhl7'
ID402933
Institutional Source Beutler Lab
Gene Symbol Klhl7
Ensembl Gene ENSMUSG00000028986
Gene Namekelch-like 7
Synonyms2700038B03Rik, SBBI26, D5Ertd363e, Klhl6
MMRRC Submission 042841-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R5284 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location24100605-24160792 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24159617 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 550 (T550A)
Ref Sequence ENSEMBL: ENSMUSP00000030841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030841] [ENSMUST00000163409] [ENSMUST00000200116]
Predicted Effect probably benign
Transcript: ENSMUST00000030841
AA Change: T550A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000030841
Gene: ENSMUSG00000028986
AA Change: T550A

DomainStartEndE-ValueType
low complexity region 7 28 N/A INTRINSIC
BTB 44 141 7.49e-29 SMART
BACK 146 248 8.42e-36 SMART
Kelch 337 382 7.5e0 SMART
Kelch 383 430 1.97e-7 SMART
Kelch 431 481 2.25e-11 SMART
Kelch 482 528 4.4e-5 SMART
Blast:Kelch 529 576 1e-25 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000163409
SMART Domains Protein: ENSMUSP00000129461
Gene: ENSMUSG00000028986

DomainStartEndE-ValueType
low complexity region 7 28 N/A INTRINSIC
BTB 44 141 7.49e-29 SMART
BACK 146 248 8.42e-36 SMART
Kelch 337 382 7.5e0 SMART
Kelch 383 430 1.97e-7 SMART
Kelch 431 470 4.1e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196080
Predicted Effect probably benign
Transcript: ENSMUST00000200116
SMART Domains Protein: ENSMUSP00000143000
Gene: ENSMUSG00000028986

DomainStartEndE-ValueType
low complexity region 7 28 N/A INTRINSIC
BTB 44 141 4.7e-31 SMART
BACK 146 248 6.3e-40 SMART
Pfam:Kelch_1 325 365 2.4e-4 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a BTB-Kelch-related protein. The encoded protein may be involved in protein degradation. Mutations in this gene have been associated with retinitis pigmentosa 42. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T A 7: 45,981,059 Q1259L probably benign Het
AI314180 C T 4: 58,836,172 E723K possibly damaging Het
Arhgef26 T C 3: 62,419,631 S522P probably damaging Het
Asic5 C T 3: 82,008,523 P218L probably damaging Het
Atad1 T C 19: 32,687,271 M248V probably benign Het
Bank1 T C 3: 136,064,154 D522G probably damaging Het
Bod1l G A 5: 41,820,467 S1168L probably benign Het
Cactin A G 10: 81,323,762 D51G probably damaging Het
Camkk1 A G 11: 73,037,555 D261G probably benign Het
Cep152 A G 2: 125,580,021 S930P probably damaging Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Crim1 A T 17: 78,313,266 R378S possibly damaging Het
Dcun1d4 T C 5: 73,522,682 probably null Het
Dhdds A G 4: 133,980,212 V187A probably benign Het
Egfem1 A G 3: 29,650,787 E251G possibly damaging Het
Ehhadh T C 16: 21,763,344 probably null Het
Ep400 A G 5: 110,668,124 V2724A probably damaging Het
Epb41l4a T A 18: 33,798,800 T581S probably damaging Het
Erg C T 16: 95,459,243 M1I probably null Het
Fastkd1 T C 2: 69,712,188 T92A probably benign Het
Gabpb1 T C 2: 126,652,357 H116R possibly damaging Het
Gucy2c A G 6: 136,763,043 L262P possibly damaging Het
Ifi203 C T 1: 173,928,708 probably benign Het
Kcnk13 A C 12: 100,061,289 I208L probably benign Het
Krtap12-1 G T 10: 77,720,965 C114F possibly damaging Het
Myh7b A G 2: 155,632,314 T1650A probably benign Het
Myo19 T A 11: 84,885,272 probably null Het
Nav1 C T 1: 135,449,963 W1656* probably null Het
Nup188 A T 2: 30,330,635 S907C probably damaging Het
Olfr212 T A 6: 116,516,552 Y258* probably null Het
Oplah A T 15: 76,306,559 H125Q probably benign Het
Pcnx A T 12: 81,919,029 T657S probably benign Het
Phf14 C A 6: 11,997,120 Q796K probably damaging Het
Plaa T C 4: 94,569,637 I699V probably benign Het
Prex2 C A 1: 11,266,090 S1504* probably null Het
Prpf18 G A 2: 4,645,670 Q50* probably null Het
Rnf213 A G 11: 119,458,866 Y3851C possibly damaging Het
Rpgrip1 A G 14: 52,149,276 D726G probably damaging Het
Sacm1l T C 9: 123,586,420 S487P probably damaging Het
Setdb1 G T 3: 95,327,570 R941S probably damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Smg8 G A 11: 87,080,311 S878L possibly damaging Het
Trpc4 T A 3: 54,279,947 V440E probably damaging Het
Tsen15 A G 1: 152,371,873 S123P probably damaging Het
Tspan12 G T 6: 21,835,467 A69D probably damaging Het
Ubiad1 G A 4: 148,436,498 T223M probably damaging Het
Ubtfl1 A T 9: 18,409,445 K90* probably null Het
Wdr19 C T 5: 65,225,409 T492I probably damaging Het
Zfp423 C T 8: 87,781,677 D659N possibly damaging Het
Other mutations in Klhl7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Klhl7 APN 5 24141281 nonsense probably null
IGL03149:Klhl7 APN 5 24159689 missense probably benign 0.02
R0433:Klhl7 UTSW 5 24127702 missense probably damaging 0.98
R1301:Klhl7 UTSW 5 24159491 missense probably damaging 1.00
R1521:Klhl7 UTSW 5 24149110 splice site probably null
R2143:Klhl7 UTSW 5 24100863 missense probably benign
R2144:Klhl7 UTSW 5 24100863 missense probably benign
R2145:Klhl7 UTSW 5 24100863 missense probably benign
R3409:Klhl7 UTSW 5 24138321 missense probably damaging 0.96
R3410:Klhl7 UTSW 5 24138321 missense probably damaging 0.96
R3411:Klhl7 UTSW 5 24138321 missense probably damaging 0.96
R4927:Klhl7 UTSW 5 24141187 missense possibly damaging 0.81
R5316:Klhl7 UTSW 5 24127750 missense probably benign 0.30
R5400:Klhl7 UTSW 5 24126920 missense probably damaging 1.00
R6644:Klhl7 UTSW 5 24149246 missense probably damaging 1.00
R7122:Klhl7 UTSW 5 24138435 missense probably damaging 0.99
R7567:Klhl7 UTSW 5 24126846 missense probably benign
R7658:Klhl7 UTSW 5 24141286 missense probably benign 0.11
X0067:Klhl7 UTSW 5 24141295 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGAAGGTGGTCTGGACAATG -3'
(R):5'- TTCTCTGATGAGCATGCCCC -3'

Sequencing Primer
(F):5'- GTCTGGACAATGTGGAATATTACG -3'
(R):5'- CGAACTCTTGGAATAAACCACTGGTG -3'
Posted On2016-07-22