Incidental Mutation 'R5284:Tspan12'
ID402939
Institutional Source Beutler Lab
Gene Symbol Tspan12
Ensembl Gene ENSMUSG00000029669
Gene Nametetraspanin 12
SynonymsTm4sf12
MMRRC Submission 042841-MU
Accession Numbers

Genbank: NM_173007; MGI: 1889818

Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R5284 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location21771395-21852515 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 21835467 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 69 (A69D)
Ref Sequence ENSEMBL: ENSMUSP00000123475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031678] [ENSMUST00000120965] [ENSMUST00000123116] [ENSMUST00000134635] [ENSMUST00000143531]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031678
AA Change: A69D

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031678
Gene: ENSMUSG00000029669
AA Change: A69D

DomainStartEndE-ValueType
Pfam:Tetraspannin 9 248 1.1e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120965
AA Change: A69D

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113384
Gene: ENSMUSG00000029669
AA Change: A69D

DomainStartEndE-ValueType
Pfam:Tetraspannin 9 156 4.1e-23 PFAM
transmembrane domain 180 202 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123116
AA Change: A69D

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117820
Gene: ENSMUSG00000029669
AA Change: A69D

DomainStartEndE-ValueType
Pfam:Tetraspannin 9 203 4.1e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134635
AA Change: A69D

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123475
Gene: ENSMUSG00000029669
AA Change: A69D

DomainStartEndE-ValueType
Pfam:Tetraspannin 9 129 1.8e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143531
AA Change: A3D

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal retinal vasculature with pericapillary occlusions, lack of vertical sprouts, gliosis, fenestration, microanurysms, hemorrhage, and delayed regression of hyaloid capillaries. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T A 7: 45,981,059 Q1259L probably benign Het
AI314180 C T 4: 58,836,172 E723K possibly damaging Het
Arhgef26 T C 3: 62,419,631 S522P probably damaging Het
Asic5 C T 3: 82,008,523 P218L probably damaging Het
Atad1 T C 19: 32,687,271 M248V probably benign Het
Bank1 T C 3: 136,064,154 D522G probably damaging Het
Bod1l G A 5: 41,820,467 S1168L probably benign Het
Cactin A G 10: 81,323,762 D51G probably damaging Het
Camkk1 A G 11: 73,037,555 D261G probably benign Het
Cep152 A G 2: 125,580,021 S930P probably damaging Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Crim1 A T 17: 78,313,266 R378S possibly damaging Het
Dcun1d4 T C 5: 73,522,682 probably null Het
Dhdds A G 4: 133,980,212 V187A probably benign Het
Egfem1 A G 3: 29,650,787 E251G possibly damaging Het
Ehhadh T C 16: 21,763,344 probably null Het
Ep400 A G 5: 110,668,124 V2724A probably damaging Het
Epb41l4a T A 18: 33,798,800 T581S probably damaging Het
Erg C T 16: 95,459,243 M1I probably null Het
Fastkd1 T C 2: 69,712,188 T92A probably benign Het
Gabpb1 T C 2: 126,652,357 H116R possibly damaging Het
Gucy2c A G 6: 136,763,043 L262P possibly damaging Het
Ifi203 C T 1: 173,928,708 probably benign Het
Kcnk13 A C 12: 100,061,289 I208L probably benign Het
Klhl7 A G 5: 24,159,617 T550A probably benign Het
Krtap12-1 G T 10: 77,720,965 C114F possibly damaging Het
Myh7b A G 2: 155,632,314 T1650A probably benign Het
Myo19 T A 11: 84,885,272 probably null Het
Nav1 C T 1: 135,449,963 W1656* probably null Het
Nup188 A T 2: 30,330,635 S907C probably damaging Het
Olfr212 T A 6: 116,516,552 Y258* probably null Het
Oplah A T 15: 76,306,559 H125Q probably benign Het
Pcnx A T 12: 81,919,029 T657S probably benign Het
Phf14 C A 6: 11,997,120 Q796K probably damaging Het
Plaa T C 4: 94,569,637 I699V probably benign Het
Prex2 C A 1: 11,266,090 S1504* probably null Het
Prpf18 G A 2: 4,645,670 Q50* probably null Het
Rnf213 A G 11: 119,458,866 Y3851C possibly damaging Het
Rpgrip1 A G 14: 52,149,276 D726G probably damaging Het
Sacm1l T C 9: 123,586,420 S487P probably damaging Het
Setdb1 G T 3: 95,327,570 R941S probably damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Smg8 G A 11: 87,080,311 S878L possibly damaging Het
Trpc4 T A 3: 54,279,947 V440E probably damaging Het
Tsen15 A G 1: 152,371,873 S123P probably damaging Het
Ubiad1 G A 4: 148,436,498 T223M probably damaging Het
Ubtfl1 A T 9: 18,409,445 K90* probably null Het
Wdr19 C T 5: 65,225,409 T492I probably damaging Het
Zfp423 C T 8: 87,781,677 D659N possibly damaging Het
Other mutations in Tspan12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Tspan12 APN 6 21851082 utr 5 prime probably benign
IGL02601:Tspan12 APN 6 21835379 unclassified probably benign
IGL02992:Tspan12 APN 6 21799877 critical splice donor site probably null
PIT4362001:Tspan12 UTSW 6 21835464 missense possibly damaging 0.87
R1800:Tspan12 UTSW 6 21795700 missense probably damaging 1.00
R1862:Tspan12 UTSW 6 21851023 missense probably damaging 1.00
R1898:Tspan12 UTSW 6 21795694 missense probably damaging 0.97
R2101:Tspan12 UTSW 6 21799888 missense probably benign 0.00
R2351:Tspan12 UTSW 6 21835507 missense probably benign
R4820:Tspan12 UTSW 6 21795661 missense probably damaging 0.99
R4921:Tspan12 UTSW 6 21835449 missense possibly damaging 0.66
R5341:Tspan12 UTSW 6 21835459 missense possibly damaging 0.69
R5372:Tspan12 UTSW 6 21772699 missense probably benign 0.06
R5929:Tspan12 UTSW 6 21772747 missense possibly damaging 0.92
R6052:Tspan12 UTSW 6 21772638 missense probably benign 0.09
R6108:Tspan12 UTSW 6 21772771 missense probably benign
R6207:Tspan12 UTSW 6 21799908 missense probably damaging 1.00
R6248:Tspan12 UTSW 6 21799971 missense probably damaging 1.00
R7014:Tspan12 UTSW 6 21772919 missense probably benign 0.01
R7457:Tspan12 UTSW 6 21772683 missense probably benign 0.09
R7776:Tspan12 UTSW 6 21836443 missense probably damaging 1.00
ZE80:Tspan12 UTSW 6 21795609 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ATCTCCTAGGGAATGAAAGTGCC -3'
(R):5'- GGATGCCAATTTGGAGAGCTG -3'

Sequencing Primer
(F):5'- TCTTACAGGAGCTGCATAGTGACC -3'
(R):5'- CTGGAGCTCTCAGTAGCATTTGC -3'
Posted On2016-07-22