Incidental Mutation 'R5284:Pcnx'
ID402954
Institutional Source Beutler Lab
Gene Symbol Pcnx
Ensembl Gene ENSMUSG00000021140
Gene Namepecanex homolog
Synonyms3526401J03Rik, 2900024E21Rik
MMRRC Submission 042841-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5284 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location81860023-82000924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81919029 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 657 (T657S)
Ref Sequence ENSEMBL: ENSMUSP00000152302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021567] [ENSMUST00000221721] [ENSMUST00000222005]
Predicted Effect probably benign
Transcript: ENSMUST00000021567
AA Change: T657S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021567
Gene: ENSMUSG00000021140
AA Change: T657S

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
low complexity region 369 390 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
low complexity region 509 525 N/A INTRINSIC
low complexity region 616 638 N/A INTRINSIC
low complexity region 672 692 N/A INTRINSIC
low complexity region 764 783 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 842 853 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
transmembrane domain 1006 1028 N/A INTRINSIC
transmembrane domain 1035 1052 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1113 1135 N/A INTRINSIC
transmembrane domain 1163 1185 N/A INTRINSIC
transmembrane domain 1197 1216 N/A INTRINSIC
transmembrane domain 1269 1291 N/A INTRINSIC
transmembrane domain 1298 1315 N/A INTRINSIC
Pfam:Pecanex_C 1785 2011 1.6e-118 PFAM
low complexity region 2125 2140 N/A INTRINSIC
low complexity region 2195 2202 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000221675
AA Change: T129S
Predicted Effect probably benign
Transcript: ENSMUST00000221721
AA Change: T657S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000222005
AA Change: T657S

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved transmembrane protein similar to the pecanex protein in Drosophila. The fly protein is a component of the Notch signaling pathway, which functions in several developmental processes. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T A 7: 45,981,059 Q1259L probably benign Het
AI314180 C T 4: 58,836,172 E723K possibly damaging Het
Arhgef26 T C 3: 62,419,631 S522P probably damaging Het
Asic5 C T 3: 82,008,523 P218L probably damaging Het
Atad1 T C 19: 32,687,271 M248V probably benign Het
Bank1 T C 3: 136,064,154 D522G probably damaging Het
Bod1l G A 5: 41,820,467 S1168L probably benign Het
Cactin A G 10: 81,323,762 D51G probably damaging Het
Camkk1 A G 11: 73,037,555 D261G probably benign Het
Cep152 A G 2: 125,580,021 S930P probably damaging Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Crim1 A T 17: 78,313,266 R378S possibly damaging Het
Dcun1d4 T C 5: 73,522,682 probably null Het
Dhdds A G 4: 133,980,212 V187A probably benign Het
Egfem1 A G 3: 29,650,787 E251G possibly damaging Het
Ehhadh T C 16: 21,763,344 probably null Het
Ep400 A G 5: 110,668,124 V2724A probably damaging Het
Epb41l4a T A 18: 33,798,800 T581S probably damaging Het
Erg C T 16: 95,459,243 M1I probably null Het
Fastkd1 T C 2: 69,712,188 T92A probably benign Het
Gabpb1 T C 2: 126,652,357 H116R possibly damaging Het
Gucy2c A G 6: 136,763,043 L262P possibly damaging Het
Ifi203 C T 1: 173,928,708 probably benign Het
Kcnk13 A C 12: 100,061,289 I208L probably benign Het
Klhl7 A G 5: 24,159,617 T550A probably benign Het
Krtap12-1 G T 10: 77,720,965 C114F possibly damaging Het
Myh7b A G 2: 155,632,314 T1650A probably benign Het
Myo19 T A 11: 84,885,272 probably null Het
Nav1 C T 1: 135,449,963 W1656* probably null Het
Nup188 A T 2: 30,330,635 S907C probably damaging Het
Olfr212 T A 6: 116,516,552 Y258* probably null Het
Oplah A T 15: 76,306,559 H125Q probably benign Het
Phf14 C A 6: 11,997,120 Q796K probably damaging Het
Plaa T C 4: 94,569,637 I699V probably benign Het
Prex2 C A 1: 11,266,090 S1504* probably null Het
Prpf18 G A 2: 4,645,670 Q50* probably null Het
Rnf213 A G 11: 119,458,866 Y3851C possibly damaging Het
Rpgrip1 A G 14: 52,149,276 D726G probably damaging Het
Sacm1l T C 9: 123,586,420 S487P probably damaging Het
Setdb1 G T 3: 95,327,570 R941S probably damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Smg8 G A 11: 87,080,311 S878L possibly damaging Het
Trpc4 T A 3: 54,279,947 V440E probably damaging Het
Tsen15 A G 1: 152,371,873 S123P probably damaging Het
Tspan12 G T 6: 21,835,467 A69D probably damaging Het
Ubiad1 G A 4: 148,436,498 T223M probably damaging Het
Ubtfl1 A T 9: 18,409,445 K90* probably null Het
Wdr19 C T 5: 65,225,409 T492I probably damaging Het
Zfp423 C T 8: 87,781,677 D659N possibly damaging Het
Other mutations in Pcnx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Pcnx APN 12 81895101 missense probably damaging 0.98
IGL00561:Pcnx APN 12 81996053 missense probably damaging 1.00
IGL01066:Pcnx APN 12 81992021 missense possibly damaging 0.87
IGL01069:Pcnx APN 12 81918144 missense probably benign 0.27
IGL01082:Pcnx APN 12 81990598 missense possibly damaging 0.62
IGL01087:Pcnx APN 12 81995339 splice site probably benign
IGL01145:Pcnx APN 12 81992035 missense probably damaging 0.99
IGL01412:Pcnx APN 12 81906465 missense probably damaging 1.00
IGL01477:Pcnx APN 12 81973241 missense probably damaging 0.98
IGL01639:Pcnx APN 12 81950320 critical splice donor site probably null
IGL01815:Pcnx APN 12 81990551 missense probably damaging 1.00
IGL01870:Pcnx APN 12 81975893 missense probably benign 0.01
IGL01902:Pcnx APN 12 81979094 missense probably damaging 1.00
IGL01935:Pcnx APN 12 81917816 missense probably benign 0.00
IGL02141:Pcnx APN 12 81860382 missense possibly damaging 0.86
IGL02179:Pcnx APN 12 81933719 intron probably benign
IGL02197:Pcnx APN 12 81919104 missense probably benign 0.01
IGL02197:Pcnx APN 12 81993151 missense possibly damaging 0.85
IGL02238:Pcnx APN 12 81917914 missense probably damaging 1.00
IGL02430:Pcnx APN 12 81919322 missense possibly damaging 0.89
IGL02590:Pcnx APN 12 81994978 missense probably damaging 1.00
IGL02992:Pcnx APN 12 81964120 missense probably damaging 1.00
IGL03304:Pcnx APN 12 81982029 missense probably damaging 1.00
PIT4515001:Pcnx UTSW 12 81991787 missense
R0086:Pcnx UTSW 12 81992058 unclassified probably benign
R0114:Pcnx UTSW 12 81996095 missense possibly damaging 0.95
R0240:Pcnx UTSW 12 81947018 missense possibly damaging 0.67
R0240:Pcnx UTSW 12 81947018 missense possibly damaging 0.67
R0376:Pcnx UTSW 12 81974579 splice site probably benign
R0377:Pcnx UTSW 12 81974579 splice site probably benign
R0416:Pcnx UTSW 12 81974466 missense probably benign 0.09
R0514:Pcnx UTSW 12 81995110 missense probably benign 0.21
R0563:Pcnx UTSW 12 81917944 missense probably damaging 1.00
R0569:Pcnx UTSW 12 81992030 missense probably benign 0.08
R0626:Pcnx UTSW 12 81983676 missense possibly damaging 0.82
R0972:Pcnx UTSW 12 81913412 missense probably damaging 1.00
R1205:Pcnx UTSW 12 81956243 missense probably damaging 1.00
R1455:Pcnx UTSW 12 81973234 missense probably damaging 1.00
R1514:Pcnx UTSW 12 81918798 missense probably damaging 1.00
R1731:Pcnx UTSW 12 81990704 missense probably damaging 1.00
R1758:Pcnx UTSW 12 81983484 missense probably benign 0.27
R1774:Pcnx UTSW 12 81975320 missense probably damaging 1.00
R1817:Pcnx UTSW 12 81918642 missense probably benign
R1843:Pcnx UTSW 12 81980935 missense probably damaging 1.00
R1862:Pcnx UTSW 12 81918732 missense probably damaging 1.00
R2042:Pcnx UTSW 12 81918293 missense probably damaging 1.00
R2054:Pcnx UTSW 12 81933674 missense probably benign 0.02
R2243:Pcnx UTSW 12 81918705 missense probably damaging 1.00
R2272:Pcnx UTSW 12 81995314 missense probably benign 0.26
R2360:Pcnx UTSW 12 81950186 missense probably damaging 0.99
R2926:Pcnx UTSW 12 81994995 missense probably damaging 1.00
R3607:Pcnx UTSW 12 81928292 missense probably damaging 1.00
R3781:Pcnx UTSW 12 81996118 missense probably benign 0.00
R3782:Pcnx UTSW 12 81996118 missense probably benign 0.00
R3806:Pcnx UTSW 12 81950137 missense possibly damaging 0.84
R3926:Pcnx UTSW 12 81958731 missense probably damaging 1.00
R4019:Pcnx UTSW 12 81918244 missense probably damaging 1.00
R4020:Pcnx UTSW 12 81918244 missense probably damaging 1.00
R4683:Pcnx UTSW 12 81986672 missense probably benign 0.01
R4703:Pcnx UTSW 12 81895164 missense probably benign 0.01
R4732:Pcnx UTSW 12 81995751 missense probably benign 0.01
R4733:Pcnx UTSW 12 81995751 missense probably benign 0.01
R4755:Pcnx UTSW 12 81950294 missense probably damaging 1.00
R4792:Pcnx UTSW 12 81919151 missense probably damaging 1.00
R4897:Pcnx UTSW 12 81918165 missense probably damaging 1.00
R4915:Pcnx UTSW 12 81974495 missense probably benign 0.10
R4934:Pcnx UTSW 12 81991825 missense possibly damaging 0.76
R4940:Pcnx UTSW 12 81917793 missense possibly damaging 0.60
R5079:Pcnx UTSW 12 81979089 nonsense probably null
R5087:Pcnx UTSW 12 81994939 missense probably damaging 1.00
R5287:Pcnx UTSW 12 81982051 missense probably damaging 1.00
R5436:Pcnx UTSW 12 81860406 missense probably damaging 1.00
R5505:Pcnx UTSW 12 81950153 missense probably damaging 1.00
R5538:Pcnx UTSW 12 81860409 missense probably damaging 1.00
R5632:Pcnx UTSW 12 81917730 missense probably damaging 1.00
R5642:Pcnx UTSW 12 81895029 missense possibly damaging 0.45
R5841:Pcnx UTSW 12 81918655 missense possibly damaging 0.62
R6275:Pcnx UTSW 12 81918607 missense probably benign 0.34
R6508:Pcnx UTSW 12 81912705 missense probably damaging 0.98
R6532:Pcnx UTSW 12 81980964 missense probably damaging 1.00
R6634:Pcnx UTSW 12 81917882 nonsense probably null
R6753:Pcnx UTSW 12 81964480 missense probably damaging 1.00
R6776:Pcnx UTSW 12 81962722 missense possibly damaging 0.81
R6778:Pcnx UTSW 12 81918871 missense probably damaging 1.00
R6890:Pcnx UTSW 12 81971376 missense probably benign 0.09
R6894:Pcnx UTSW 12 81987973 missense probably damaging 1.00
R6927:Pcnx UTSW 12 81917812 missense probably benign 0.37
R7173:Pcnx UTSW 12 81953003 intron probably null
R7196:Pcnx UTSW 12 81995538 missense possibly damaging 0.94
R7316:Pcnx UTSW 12 81995549 missense probably benign 0.16
R7559:Pcnx UTSW 12 81993122 missense unknown
R7635:Pcnx UTSW 12 81919125 missense
R7669:Pcnx UTSW 12 81990551 missense probably damaging 1.00
R8021:Pcnx UTSW 12 81918819 nonsense probably null
R8049:Pcnx UTSW 12 81918819 nonsense probably null
R8078:Pcnx UTSW 12 81975280 missense
R8093:Pcnx UTSW 12 81918819 nonsense probably null
R8104:Pcnx UTSW 12 81983611 nonsense probably null
R8108:Pcnx UTSW 12 81918819 nonsense probably null
R8131:Pcnx UTSW 12 81918518 missense possibly damaging 0.80
R8136:Pcnx UTSW 12 81918006 missense probably benign
R8153:Pcnx UTSW 12 81918819 nonsense probably null
R8156:Pcnx UTSW 12 81918819 nonsense probably null
RF024:Pcnx UTSW 12 81917727 missense probably damaging 0.98
Z1177:Pcnx UTSW 12 81918202 missense probably damaging 0.98
Z1177:Pcnx UTSW 12 81918677 missense
Predicted Primers PCR Primer
(F):5'- AGGAGTCTCTGGAACCAAGC -3'
(R):5'- GGTTAAGGGCTTCATACTGTCC -3'

Sequencing Primer
(F):5'- AAGCCGCACAGTGCTGTATTTG -3'
(R):5'- TCATACTGTCCGGTGCCAG -3'
Posted On2016-07-22