Incidental Mutation 'R5285:Lrrn2'
ID402963
Institutional Source Beutler Lab
Gene Symbol Lrrn2
Ensembl Gene ENSMUSG00000026443
Gene Nameleucine rich repeat protein 2, neuronal
SynonymsNLRR-2, 5730406J09Rik
MMRRC Submission 042869-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R5285 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location132880273-132940005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 132939245 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 683 (S683T)
Ref Sequence ENSEMBL: ENSMUSP00000027706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027706]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027706
AA Change: S683T

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027706
Gene: ENSMUSG00000026443
AA Change: S683T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 28 73 2.22e-2 SMART
LRR 92 115 3.86e0 SMART
LRR 116 139 1.08e-1 SMART
LRR_TYP 140 163 3.21e-4 SMART
LRR 164 187 1.33e-1 SMART
LRR 188 211 5.89e1 SMART
LRR 212 235 1.66e1 SMART
LRR 236 259 4.98e-1 SMART
LRR 260 283 5.26e0 SMART
LRR 309 333 5.56e0 SMART
LRR 334 357 2.17e-1 SMART
LRRCT 369 421 3.13e-3 SMART
IGc2 436 504 9.99e-13 SMART
FN3 525 607 3.49e0 SMART
transmembrane domain 629 651 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159088
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194934
Meta Mutation Damage Score 0.1986 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the leucine-rich repeat superfamily. This gene was found to be amplified and overexpressed in malignant gliomas. The encoded protein has homology with other proteins that function as cell-adhesion molecules or as signal transduction receptors and is a candidate for the target gene in the 1q32.1 amplicon in malignant gliomas. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibited numerous neurological abnormalities when compared with controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,708,465 T12A probably benign Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Adcy8 G T 15: 64,767,857 H685N possibly damaging Het
Aldh1l1 A T 6: 90,576,770 K539* probably null Het
Ap1m2 G T 9: 21,305,637 Y134* probably null Het
Apobr A G 7: 126,585,003 probably benign Het
Atl1 A G 12: 69,954,499 K345R probably benign Het
Avil T C 10: 127,018,459 L765P probably damaging Het
Caps2 T A 10: 112,208,311 Y472N probably benign Het
Cd177 A T 7: 24,746,249 S590T probably benign Het
Cep295 T C 9: 15,322,591 D2223G probably benign Het
Cfh T C 1: 140,100,898 T493A probably benign Het
Chek1 T C 9: 36,714,452 D299G probably benign Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Crhr1 A T 11: 104,170,497 I243F possibly damaging Het
Cyp3a11 A G 5: 145,855,083 V500A probably benign Het
Dcdc5 A T 2: 106,368,155 noncoding transcript Het
Ergic3 A G 2: 156,018,037 probably benign Het
Fabp3-ps1 T G 10: 86,732,202 probably benign Het
Gm16432 A G 1: 178,103,888 K458E unknown Het
Gm6445 C A 19: 9,607,668 noncoding transcript Het
Gucy2d C A 7: 98,458,267 probably null Het
Ighv1-19-1 C A 12: 114,704,252 probably benign Het
Igkv2-116 G T 6: 68,152,479 R75L probably benign Het
Inhbc C A 10: 127,357,400 R249L probably damaging Het
Lyst T C 13: 13,634,426 V227A probably benign Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Msh4 T C 3: 153,873,713 N587S probably benign Het
Mug1 G A 6: 121,841,107 E126K probably benign Het
Nav2 T C 7: 49,548,234 S1204P probably damaging Het
Ncor1 A G 11: 62,392,649 I413T probably damaging Het
Nipa2 A T 7: 55,933,012 Y328* probably null Het
Olfr178 A T 16: 58,890,108 Y37* probably null Het
Olfr195 T C 16: 59,149,270 L140P probably damaging Het
Olfr384 T A 11: 73,602,941 Y120* probably null Het
Olfr593 C T 7: 103,212,798 R302* probably null Het
Olfr645 A G 7: 104,084,133 *316R probably null Het
Pla2g4e T C 2: 120,189,504 D155G probably damaging Het
Plxnb1 C T 9: 109,108,459 T1176I probably damaging Het
Polg A G 7: 79,465,225 probably benign Het
Prl8a2 G A 13: 27,350,133 probably null Het
Prmt7 G A 8: 106,248,359 R529Q probably benign Het
Psg17 T A 7: 18,820,201 L41F probably benign Het
Rad18 T C 6: 112,686,765 R73G probably benign Het
Rhpn2 G T 7: 35,381,565 probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sarm1 A G 11: 78,497,439 F7S probably benign Het
Sgip1 T A 4: 102,921,477 probably benign Het
Sh3gl2 A G 4: 85,376,449 K99R probably benign Het
Sorbs1 G A 19: 40,321,890 T1018I probably damaging Het
Spns2 G A 11: 72,489,479 A106V possibly damaging Het
Stab1 A G 14: 31,143,476 probably benign Het
Steap3 T C 1: 120,241,880 D191G probably damaging Het
Stxbp5 T C 10: 9,798,275 probably null Het
Sycp2 A T 2: 178,392,398 probably null Het
Tm6sf1 A G 7: 81,859,452 S2G possibly damaging Het
Usp24 T A 4: 106,407,033 D1720E probably benign Het
Vmn1r200 G A 13: 22,395,287 E78K possibly damaging Het
Vmn2r120 A G 17: 57,536,703 L47P probably damaging Het
Vmn2r14 T C 5: 109,217,576 N544S probably damaging Het
Vwa1 C T 4: 155,770,895 A254T probably benign Het
Zfp7 G A 15: 76,891,222 R488Q probably damaging Het
Zfp940 A T 7: 29,845,600 L294H probably damaging Het
Other mutations in Lrrn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01387:Lrrn2 APN 1 132938358 missense possibly damaging 0.89
IGL01407:Lrrn2 APN 1 132937227 missense probably damaging 1.00
IGL01636:Lrrn2 APN 1 132937221 missense possibly damaging 0.95
IGL02134:Lrrn2 APN 1 132937817 missense possibly damaging 0.69
IGL02142:Lrrn2 APN 1 132939245 missense possibly damaging 0.86
IGL03240:Lrrn2 APN 1 132938327 missense possibly damaging 0.53
R0226:Lrrn2 UTSW 1 132937820 missense probably damaging 1.00
R0612:Lrrn2 UTSW 1 132937728 missense probably damaging 1.00
R1185:Lrrn2 UTSW 1 132939221 missense probably benign 0.00
R1185:Lrrn2 UTSW 1 132939221 missense probably benign 0.00
R1185:Lrrn2 UTSW 1 132939221 missense probably benign 0.00
R1969:Lrrn2 UTSW 1 132939234 missense probably benign 0.00
R2087:Lrrn2 UTSW 1 132937751 missense probably damaging 1.00
R3923:Lrrn2 UTSW 1 132938492 missense probably benign 0.45
R4006:Lrrn2 UTSW 1 132937740 missense probably damaging 1.00
R4022:Lrrn2 UTSW 1 132939114 missense probably benign
R4091:Lrrn2 UTSW 1 132937652 nonsense probably null
R4092:Lrrn2 UTSW 1 132937652 nonsense probably null
R4719:Lrrn2 UTSW 1 132939177 missense probably benign
R5681:Lrrn2 UTSW 1 132937161 start gained probably benign
R5791:Lrrn2 UTSW 1 132937767 missense probably benign 0.00
R5916:Lrrn2 UTSW 1 132937800 missense probably damaging 1.00
R6646:Lrrn2 UTSW 1 132939056 missense probably benign
R7021:Lrrn2 UTSW 1 132938784 missense probably damaging 1.00
R7686:Lrrn2 UTSW 1 132938594 missense probably benign 0.04
R7811:Lrrn2 UTSW 1 132939201 missense probably benign
R7869:Lrrn2 UTSW 1 132939378 missense unknown
R8004:Lrrn2 UTSW 1 132937751 missense probably damaging 1.00
R8195:Lrrn2 UTSW 1 132937344 missense probably damaging 1.00
R8815:Lrrn2 UTSW 1 132939093 missense possibly damaging 0.87
Z1177:Lrrn2 UTSW 1 132937898 nonsense probably null
Z1177:Lrrn2 UTSW 1 132938978 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTTTGGGCCAGGACTAAAGAG -3'
(R):5'- GTGGATCAATCAACGCCACG -3'

Sequencing Primer
(F):5'- GCCTCTCCTTGCCACAGAG -3'
(R):5'- ACGTTCCTGGCAGGCATCTG -3'
Posted On2016-07-22