Incidental Mutation 'R5285:Nipa2'
ID402987
Institutional Source Beutler Lab
Gene Symbol Nipa2
Ensembl Gene ENSMUSG00000030452
Gene Namenon imprinted in Prader-Willi/Angelman syndrome 2 homolog (human)
Synonyms
MMRRC Submission 042869-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.888) question?
Stock #R5285 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location55931287-55962476 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 55933012 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 328 (Y328*)
Ref Sequence ENSEMBL: ENSMUSP00000114020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032629] [ENSMUST00000032635] [ENSMUST00000085255] [ENSMUST00000117812] [ENSMUST00000119041] [ENSMUST00000119201] [ENSMUST00000126604] [ENSMUST00000152649] [ENSMUST00000163845]
Predicted Effect probably benign
Transcript: ENSMUST00000032629
SMART Domains Protein: ENSMUSP00000032629
Gene: ENSMUSG00000030447

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:DUF1394 59 302 5.7e-11 PFAM
Pfam:FragX_IP 389 1222 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000032635
AA Change: Y328*
SMART Domains Protein: ENSMUSP00000032635
Gene: ENSMUSG00000030452
AA Change: Y328*

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 6 306 3.2e-150 PFAM
Pfam:EmrE 16 135 6.2e-12 PFAM
Pfam:EamA 52 128 9.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085255
SMART Domains Protein: ENSMUSP00000082353
Gene: ENSMUSG00000030447

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:FragX_IP 385 1222 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117812
AA Change: Y328*
SMART Domains Protein: ENSMUSP00000113727
Gene: ENSMUSG00000030452
AA Change: Y328*

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 8 302 1.4e-151 PFAM
Pfam:EamA 47 128 4.3e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119041
AA Change: Y328*
SMART Domains Protein: ENSMUSP00000112394
Gene: ENSMUSG00000030452
AA Change: Y328*

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 6 306 3.2e-150 PFAM
Pfam:EmrE 16 135 6.2e-12 PFAM
Pfam:EamA 52 128 9.5e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119201
AA Change: Y328*
SMART Domains Protein: ENSMUSP00000114020
Gene: ENSMUSG00000030452
AA Change: Y328*

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 6 306 3.2e-150 PFAM
Pfam:EmrE 16 135 6.2e-12 PFAM
Pfam:EamA 52 128 9.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126604
SMART Domains Protein: ENSMUSP00000116219
Gene: ENSMUSG00000030452

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 6 130 1.2e-66 PFAM
Pfam:EmrE 14 130 1.8e-11 PFAM
Pfam:EamA 50 128 1.8e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147950
Predicted Effect probably benign
Transcript: ENSMUST00000152649
SMART Domains Protein: ENSMUSP00000120798
Gene: ENSMUSG00000030452

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 6 127 1.9e-53 PFAM
Pfam:EamA 10 109 1.8e-9 PFAM
Pfam:EmrE 18 116 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163845
SMART Domains Protein: ENSMUSP00000127717
Gene: ENSMUSG00000030447

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:FragX_IP 385 1224 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206417
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a possible magnesium transporter. This gene is located adjacent to the imprinted domain in the Prader-Willi syndrome deletion region of chromosome 15. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 3, 7 and 21.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,708,465 T12A probably benign Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Adcy8 G T 15: 64,767,857 H685N possibly damaging Het
Aldh1l1 A T 6: 90,576,770 K539* probably null Het
Ap1m2 G T 9: 21,305,637 Y134* probably null Het
Apobr A G 7: 126,585,003 probably benign Het
Atl1 A G 12: 69,954,499 K345R probably benign Het
Avil T C 10: 127,018,459 L765P probably damaging Het
Caps2 T A 10: 112,208,311 Y472N probably benign Het
Cd177 A T 7: 24,746,249 S590T probably benign Het
Cep295 T C 9: 15,322,591 D2223G probably benign Het
Cfh T C 1: 140,100,898 T493A probably benign Het
Chek1 T C 9: 36,714,452 D299G probably benign Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Crhr1 A T 11: 104,170,497 I243F possibly damaging Het
Cyp3a11 A G 5: 145,855,083 V500A probably benign Het
Dcdc5 A T 2: 106,368,155 noncoding transcript Het
Ergic3 A G 2: 156,018,037 probably benign Het
Fabp3-ps1 T G 10: 86,732,202 probably benign Het
Gm16432 A G 1: 178,103,888 K458E unknown Het
Gm6445 C A 19: 9,607,668 noncoding transcript Het
Gucy2d C A 7: 98,458,267 probably null Het
Ighv1-19-1 C A 12: 114,704,252 probably benign Het
Igkv2-116 G T 6: 68,152,479 R75L probably benign Het
Inhbc C A 10: 127,357,400 R249L probably damaging Het
Lrrn2 T A 1: 132,939,245 S683T possibly damaging Het
Lyst T C 13: 13,634,426 V227A probably benign Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Msh4 T C 3: 153,873,713 N587S probably benign Het
Mug1 G A 6: 121,841,107 E126K probably benign Het
Nav2 T C 7: 49,548,234 S1204P probably damaging Het
Ncor1 A G 11: 62,392,649 I413T probably damaging Het
Olfr178 A T 16: 58,890,108 Y37* probably null Het
Olfr195 T C 16: 59,149,270 L140P probably damaging Het
Olfr384 T A 11: 73,602,941 Y120* probably null Het
Olfr593 C T 7: 103,212,798 R302* probably null Het
Olfr645 A G 7: 104,084,133 *316R probably null Het
Pla2g4e T C 2: 120,189,504 D155G probably damaging Het
Plxnb1 C T 9: 109,108,459 T1176I probably damaging Het
Polg A G 7: 79,465,225 probably benign Het
Prl8a2 G A 13: 27,350,133 probably null Het
Prmt7 G A 8: 106,248,359 R529Q probably benign Het
Psg17 T A 7: 18,820,201 L41F probably benign Het
Rad18 T C 6: 112,686,765 R73G probably benign Het
Rhpn2 G T 7: 35,381,565 probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sarm1 A G 11: 78,497,439 F7S probably benign Het
Sgip1 T A 4: 102,921,477 probably benign Het
Sh3gl2 A G 4: 85,376,449 K99R probably benign Het
Sorbs1 G A 19: 40,321,890 T1018I probably damaging Het
Spns2 G A 11: 72,489,479 A106V possibly damaging Het
Stab1 A G 14: 31,143,476 probably benign Het
Steap3 T C 1: 120,241,880 D191G probably damaging Het
Stxbp5 T C 10: 9,798,275 probably null Het
Sycp2 A T 2: 178,392,398 probably null Het
Tm6sf1 A G 7: 81,859,452 S2G possibly damaging Het
Usp24 T A 4: 106,407,033 D1720E probably benign Het
Vmn1r200 G A 13: 22,395,287 E78K possibly damaging Het
Vmn2r120 A G 17: 57,536,703 L47P probably damaging Het
Vmn2r14 T C 5: 109,217,576 N544S probably damaging Het
Vwa1 C T 4: 155,770,895 A254T probably benign Het
Zfp7 G A 15: 76,891,222 R488Q probably damaging Het
Zfp940 A T 7: 29,845,600 L294H probably damaging Het
Other mutations in Nipa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Nipa2 APN 7 55933445 missense probably damaging 1.00
IGL01965:Nipa2 APN 7 55944623 start gained probably benign
IGL02373:Nipa2 APN 7 55933128 missense probably benign 0.01
IGL02812:Nipa2 APN 7 55943018 missense probably damaging 1.00
IGL03079:Nipa2 APN 7 55933457 missense probably damaging 1.00
IGL03188:Nipa2 APN 7 55932932 missense probably benign
R1327:Nipa2 UTSW 7 55944508 missense possibly damaging 0.81
R2356:Nipa2 UTSW 7 55932966 missense probably benign 0.00
R3758:Nipa2 UTSW 7 55935941 missense probably damaging 1.00
R3870:Nipa2 UTSW 7 55932942 missense probably damaging 1.00
R4684:Nipa2 UTSW 7 55935826 missense probably benign
R4775:Nipa2 UTSW 7 55935863 missense probably benign 0.19
R6453:Nipa2 UTSW 7 55935821 missense probably damaging 0.98
R6880:Nipa2 UTSW 7 55933251 missense probably damaging 0.99
R7459:Nipa2 UTSW 7 55933341 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATGTACTGAGGTCATATTAGTGAG -3'
(R):5'- CAACTTCAGTTTTGACTTGTTCAGC -3'

Sequencing Primer
(F):5'- TTGTCTTTAGAGGACATTATTTGAGG -3'
(R):5'- CTTTTTAAAGAATGGCAGGATATGC -3'
Posted On2016-07-22