Incidental Mutation 'R5285:Cep295'
ID402995
Institutional Source Beutler Lab
Gene Symbol Cep295
Ensembl Gene ENSMUSG00000046111
Gene Namecentrosomal protein 295
SynonymsLOC382128, 5830418K08Rik
MMRRC Submission 042869-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R5285 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location15316915-15357788 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15322591 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2223 (D2223G)
Ref Sequence ENSEMBL: ENSMUSP00000096578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098979] [ENSMUST00000161132]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000058041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000059410
Predicted Effect probably benign
Transcript: ENSMUST00000098979
AA Change: D2223G

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000096578
Gene: ENSMUSG00000046111
AA Change: D2223G

DomainStartEndE-ValueType
low complexity region 159 175 N/A INTRINSIC
coiled coil region 258 288 N/A INTRINSIC
coiled coil region 536 583 N/A INTRINSIC
coiled coil region 861 889 N/A INTRINSIC
internal_repeat_1 890 1104 6.8e-5 PROSPERO
internal_repeat_1 1277 1489 6.8e-5 PROSPERO
low complexity region 1537 1548 N/A INTRINSIC
low complexity region 1611 1625 N/A INTRINSIC
coiled coil region 1707 1736 N/A INTRINSIC
low complexity region 2003 2018 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104318
Predicted Effect probably benign
Transcript: ENSMUST00000159156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160238
Predicted Effect unknown
Transcript: ENSMUST00000160946
AA Change: D1047G
SMART Domains Protein: ENSMUSP00000125494
Gene: ENSMUSG00000046111
AA Change: D1047G

DomainStartEndE-ValueType
coiled coil region 92 119 N/A INTRINSIC
low complexity region 282 293 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
coiled coil region 451 480 N/A INTRINSIC
low complexity region 828 843 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161132
AA Change: D2303G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000123788
Gene: ENSMUSG00000046111
AA Change: D2303G

DomainStartEndE-ValueType
low complexity region 111 127 N/A INTRINSIC
coiled coil region 210 240 N/A INTRINSIC
coiled coil region 488 535 N/A INTRINSIC
coiled coil region 813 841 N/A INTRINSIC
coiled coil region 1300 1327 N/A INTRINSIC
low complexity region 1489 1500 N/A INTRINSIC
low complexity region 1563 1577 N/A INTRINSIC
coiled coil region 1659 1688 N/A INTRINSIC
low complexity region 2035 2050 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161533
Predicted Effect
SMART Domains Protein: ENSMUSP00000125035
Gene: ENSMUSG00000046111
AA Change: D2175G

DomainStartEndE-ValueType
low complexity region 111 127 N/A INTRINSIC
coiled coil region 210 240 N/A INTRINSIC
coiled coil region 488 535 N/A INTRINSIC
coiled coil region 813 841 N/A INTRINSIC
internal_repeat_1 842 1056 7.14e-5 PROSPERO
internal_repeat_1 1229 1441 7.14e-5 PROSPERO
low complexity region 1489 1500 N/A INTRINSIC
low complexity region 1563 1577 N/A INTRINSIC
coiled coil region 1659 1688 N/A INTRINSIC
low complexity region 1955 1970 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162264
Predicted Effect probably benign
Transcript: ENSMUST00000217140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217407
Meta Mutation Damage Score 0.0963 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,708,465 T12A probably benign Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Adcy8 G T 15: 64,767,857 H685N possibly damaging Het
Aldh1l1 A T 6: 90,576,770 K539* probably null Het
Ap1m2 G T 9: 21,305,637 Y134* probably null Het
Apobr A G 7: 126,585,003 probably benign Het
Atl1 A G 12: 69,954,499 K345R probably benign Het
Avil T C 10: 127,018,459 L765P probably damaging Het
Caps2 T A 10: 112,208,311 Y472N probably benign Het
Cd177 A T 7: 24,746,249 S590T probably benign Het
Cfh T C 1: 140,100,898 T493A probably benign Het
Chek1 T C 9: 36,714,452 D299G probably benign Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Crhr1 A T 11: 104,170,497 I243F possibly damaging Het
Cyp3a11 A G 5: 145,855,083 V500A probably benign Het
Dcdc5 A T 2: 106,368,155 noncoding transcript Het
Ergic3 A G 2: 156,018,037 probably benign Het
Fabp3-ps1 T G 10: 86,732,202 probably benign Het
Gm16432 A G 1: 178,103,888 K458E unknown Het
Gm6445 C A 19: 9,607,668 noncoding transcript Het
Gucy2d C A 7: 98,458,267 probably null Het
Ighv1-19-1 C A 12: 114,704,252 probably benign Het
Igkv2-116 G T 6: 68,152,479 R75L probably benign Het
Inhbc C A 10: 127,357,400 R249L probably damaging Het
Lrrn2 T A 1: 132,939,245 S683T possibly damaging Het
Lyst T C 13: 13,634,426 V227A probably benign Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Msh4 T C 3: 153,873,713 N587S probably benign Het
Mug1 G A 6: 121,841,107 E126K probably benign Het
Nav2 T C 7: 49,548,234 S1204P probably damaging Het
Ncor1 A G 11: 62,392,649 I413T probably damaging Het
Nipa2 A T 7: 55,933,012 Y328* probably null Het
Olfr178 A T 16: 58,890,108 Y37* probably null Het
Olfr195 T C 16: 59,149,270 L140P probably damaging Het
Olfr384 T A 11: 73,602,941 Y120* probably null Het
Olfr593 C T 7: 103,212,798 R302* probably null Het
Olfr645 A G 7: 104,084,133 *316R probably null Het
Pla2g4e T C 2: 120,189,504 D155G probably damaging Het
Plxnb1 C T 9: 109,108,459 T1176I probably damaging Het
Polg A G 7: 79,465,225 probably benign Het
Prl8a2 G A 13: 27,350,133 probably null Het
Prmt7 G A 8: 106,248,359 R529Q probably benign Het
Psg17 T A 7: 18,820,201 L41F probably benign Het
Rad18 T C 6: 112,686,765 R73G probably benign Het
Rhpn2 G T 7: 35,381,565 probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sarm1 A G 11: 78,497,439 F7S probably benign Het
Sgip1 T A 4: 102,921,477 probably benign Het
Sh3gl2 A G 4: 85,376,449 K99R probably benign Het
Sorbs1 G A 19: 40,321,890 T1018I probably damaging Het
Spns2 G A 11: 72,489,479 A106V possibly damaging Het
Stab1 A G 14: 31,143,476 probably benign Het
Steap3 T C 1: 120,241,880 D191G probably damaging Het
Stxbp5 T C 10: 9,798,275 probably null Het
Sycp2 A T 2: 178,392,398 probably null Het
Tm6sf1 A G 7: 81,859,452 S2G possibly damaging Het
Usp24 T A 4: 106,407,033 D1720E probably benign Het
Vmn1r200 G A 13: 22,395,287 E78K possibly damaging Het
Vmn2r120 A G 17: 57,536,703 L47P probably damaging Het
Vmn2r14 T C 5: 109,217,576 N544S probably damaging Het
Vwa1 C T 4: 155,770,895 A254T probably benign Het
Zfp7 G A 15: 76,891,222 R488Q probably damaging Het
Zfp940 A T 7: 29,845,600 L294H probably damaging Het
Other mutations in Cep295
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Cep295 APN 9 15326072 splice site probably null
IGL00769:Cep295 APN 9 15326144 missense probably damaging 1.00
IGL00771:Cep295 APN 9 15322565 missense probably damaging 1.00
IGL00850:Cep295 APN 9 15322852 missense probably benign 0.36
IGL01505:Cep295 APN 9 15318049 missense probably benign 0.08
IGL01510:Cep295 APN 9 15354626 nonsense probably null
IGL01759:Cep295 APN 9 15323559 splice site probably null
IGL02415:Cep295 APN 9 15353020 missense probably damaging 1.00
IGL02447:Cep295 APN 9 15332511 missense probably damaging 0.98
IGL02502:Cep295 APN 9 15350913 splice site probably benign
IGL02665:Cep295 APN 9 15326632 splice site probably benign
IGL02718:Cep295 APN 9 15325753 splice site probably null
IGL02995:Cep295 APN 9 15333312 missense probably damaging 1.00
IGL03024:Cep295 APN 9 15325572 missense probably benign
R0196:Cep295 UTSW 9 15338213 missense probably damaging 0.96
R0398:Cep295 UTSW 9 15354736 missense possibly damaging 0.90
R0595:Cep295 UTSW 9 15332191 nonsense probably null
R0610:Cep295 UTSW 9 15322754 missense possibly damaging 0.81
R0616:Cep295 UTSW 9 15332322 nonsense probably null
R0840:Cep295 UTSW 9 15334315 missense probably benign 0.02
R1215:Cep295 UTSW 9 15327882 missense probably benign 0.00
R1376:Cep295 UTSW 9 15340868 splice site probably benign
R1381:Cep295 UTSW 9 15322565 missense probably benign 0.02
R1484:Cep295 UTSW 9 15334784 missense probably damaging 0.99
R1557:Cep295 UTSW 9 15332010 nonsense probably null
R1655:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1682:Cep295 UTSW 9 15333921 missense probably benign 0.02
R1700:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1734:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1736:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1743:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1765:Cep295 UTSW 9 15327904 missense probably damaging 1.00
R1889:Cep295 UTSW 9 15332103 missense possibly damaging 0.94
R1895:Cep295 UTSW 9 15332103 missense possibly damaging 0.94
R1994:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1995:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R2071:Cep295 UTSW 9 15341564 missense probably damaging 1.00
R2161:Cep295 UTSW 9 15353058 missense probably damaging 0.99
R2195:Cep295 UTSW 9 15332321 missense probably damaging 0.99
R2354:Cep295 UTSW 9 15334784 missense possibly damaging 0.92
R2427:Cep295 UTSW 9 15334238 missense probably damaging 1.00
R2992:Cep295 UTSW 9 15332747 missense probably damaging 1.00
R3873:Cep295 UTSW 9 15333365 missense probably damaging 1.00
R3981:Cep295 UTSW 9 15317067 utr 3 prime probably benign
R4201:Cep295 UTSW 9 15332538 missense probably benign 0.19
R4297:Cep295 UTSW 9 15322654 missense probably benign 0.19
R4543:Cep295 UTSW 9 15335253 missense possibly damaging 0.94
R4584:Cep295 UTSW 9 15334799 missense possibly damaging 0.96
R4724:Cep295 UTSW 9 15330832 missense probably damaging 1.00
R4878:Cep295 UTSW 9 15334956 missense probably benign 0.11
R4884:Cep295 UTSW 9 15351760 missense probably damaging 1.00
R4934:Cep295 UTSW 9 15333160 missense probably damaging 0.97
R4990:Cep295 UTSW 9 15332138 missense probably damaging 1.00
R5057:Cep295 UTSW 9 15322683 missense probably benign 0.00
R5153:Cep295 UTSW 9 15357629 missense probably benign 0.32
R5180:Cep295 UTSW 9 15332120 missense probably benign
R5360:Cep295 UTSW 9 15326733 missense probably damaging 1.00
R5419:Cep295 UTSW 9 15324237 missense probably damaging 0.98
R5432:Cep295 UTSW 9 15351695 missense possibly damaging 0.95
R5625:Cep295 UTSW 9 15340891 missense probably damaging 0.99
R5637:Cep295 UTSW 9 15333812 splice site probably null
R5645:Cep295 UTSW 9 15332794 missense probably damaging 0.98
R5645:Cep295 UTSW 9 15335108 missense possibly damaging 0.89
R5678:Cep295 UTSW 9 15322858 missense probably damaging 0.99
R5688:Cep295 UTSW 9 15331986 missense probably damaging 1.00
R5807:Cep295 UTSW 9 15332532 missense probably damaging 1.00
R5824:Cep295 UTSW 9 15325656 missense possibly damaging 0.90
R5837:Cep295 UTSW 9 15346984 missense probably damaging 0.99
R5915:Cep295 UTSW 9 15341479 missense probably damaging 1.00
R5988:Cep295 UTSW 9 15341474 missense probably damaging 1.00
R6239:Cep295 UTSW 9 15322631 missense possibly damaging 0.46
R6332:Cep295 UTSW 9 15334914 missense possibly damaging 0.90
R6383:Cep295 UTSW 9 15332754 missense probably damaging 0.99
R6737:Cep295 UTSW 9 15332351 missense possibly damaging 0.90
R6929:Cep295 UTSW 9 15333062 missense probably damaging 1.00
R7428:Cep295 UTSW 9 15333498 missense possibly damaging 0.61
R7697:Cep295 UTSW 9 15354710 missense probably benign 0.01
R7963:Cep295 UTSW 9 15333441 missense possibly damaging 0.90
R8055:Cep295 UTSW 9 15333609 missense probably benign 0.00
R8069:Cep295 UTSW 9 15322586 missense possibly damaging 0.94
R8092:Cep295 UTSW 9 15332982 missense probably benign 0.17
R8117:Cep295 UTSW 9 15334364 missense probably damaging 0.99
R8140:Cep295 UTSW 9 15341533 missense probably benign 0.00
R8178:Cep295 UTSW 9 15333540 missense
R8323:Cep295 UTSW 9 15338233 missense possibly damaging 0.53
R8323:Cep295 UTSW 9 15353061 missense probably damaging 0.96
R8339:Cep295 UTSW 9 15325550 missense
R8351:Cep295 UTSW 9 15322906 missense probably damaging 0.99
R8367:Cep295 UTSW 9 15334530 missense probably benign 0.09
R8725:Cep295 UTSW 9 15332419 nonsense probably null
X0065:Cep295 UTSW 9 15322891 missense probably benign 0.36
Z1176:Cep295 UTSW 9 15357697 missense probably damaging 0.99
Z1177:Cep295 UTSW 9 15330817 missense
Predicted Primers PCR Primer
(F):5'- GCTGGCATTCTTCCAGTCAC -3'
(R):5'- GCTGTCAAGAAGGGCAGTTAC -3'

Sequencing Primer
(F):5'- GGCATTCTTCCAGTCACAATAG -3'
(R):5'- CTGTCAAGAAGGGCAGTTACAATGTC -3'
Posted On2016-07-22