Incidental Mutation 'R5285:Ap1m2'
ID402996
Institutional Source Beutler Lab
Gene Symbol Ap1m2
Ensembl Gene ENSMUSG00000003309
Gene Nameadaptor protein complex AP-1, mu 2 subunit
SynonymsD9Ertd818e, [m]1B, mu1B
MMRRC Submission 042869-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R5285 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21294275-21312337 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 21305637 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 134 (Y134*)
Ref Sequence ENSEMBL: ENSMUSP00000149196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003397] [ENSMUST00000115433] [ENSMUST00000213250] [ENSMUST00000213762]
Predicted Effect probably null
Transcript: ENSMUST00000003397
AA Change: Y134*
SMART Domains Protein: ENSMUSP00000003397
Gene: ENSMUSG00000003309
AA Change: Y134*

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 2 141 7.3e-9 PFAM
Pfam:Adap_comp_sub 157 422 7.3e-93 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115433
AA Change: Y134*
SMART Domains Protein: ENSMUSP00000111093
Gene: ENSMUSG00000003309
AA Change: Y134*

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 2 141 7.4e-9 PFAM
Pfam:Adap_comp_sub 157 424 4.7e-95 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213250
AA Change: Y99*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213483
Predicted Effect probably null
Transcript: ENSMUST00000213762
AA Change: Y134*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the heterotetrameric adaptor-related protein comlex 1 (AP-1), which belongs to the adaptor complexes medium subunits family. This protein is capable of interacting with tyrosine-based sorting signals. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice show small intestine crypt hyperplasia and villous dysplasia due to altered polarity and hyperproliferation of epithelial cells, exhibit spontaneous chronic colitis due to epithelial immune dysfunction, and develop a digestive disorder that causes malnutrition, growth retardation and early death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,708,465 T12A probably benign Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Adcy8 G T 15: 64,767,857 H685N possibly damaging Het
Aldh1l1 A T 6: 90,576,770 K539* probably null Het
Apobr A G 7: 126,585,003 probably benign Het
Atl1 A G 12: 69,954,499 K345R probably benign Het
Avil T C 10: 127,018,459 L765P probably damaging Het
Caps2 T A 10: 112,208,311 Y472N probably benign Het
Cd177 A T 7: 24,746,249 S590T probably benign Het
Cep295 T C 9: 15,322,591 D2223G probably benign Het
Cfh T C 1: 140,100,898 T493A probably benign Het
Chek1 T C 9: 36,714,452 D299G probably benign Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Crhr1 A T 11: 104,170,497 I243F possibly damaging Het
Cyp3a11 A G 5: 145,855,083 V500A probably benign Het
Dcdc5 A T 2: 106,368,155 noncoding transcript Het
Ergic3 A G 2: 156,018,037 probably benign Het
Fabp3-ps1 T G 10: 86,732,202 probably benign Het
Gm16432 A G 1: 178,103,888 K458E unknown Het
Gm6445 C A 19: 9,607,668 noncoding transcript Het
Gucy2d C A 7: 98,458,267 probably null Het
Ighv1-19-1 C A 12: 114,704,252 probably benign Het
Igkv2-116 G T 6: 68,152,479 R75L probably benign Het
Inhbc C A 10: 127,357,400 R249L probably damaging Het
Lrrn2 T A 1: 132,939,245 S683T possibly damaging Het
Lyst T C 13: 13,634,426 V227A probably benign Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Msh4 T C 3: 153,873,713 N587S probably benign Het
Mug1 G A 6: 121,841,107 E126K probably benign Het
Nav2 T C 7: 49,548,234 S1204P probably damaging Het
Ncor1 A G 11: 62,392,649 I413T probably damaging Het
Nipa2 A T 7: 55,933,012 Y328* probably null Het
Olfr178 A T 16: 58,890,108 Y37* probably null Het
Olfr195 T C 16: 59,149,270 L140P probably damaging Het
Olfr384 T A 11: 73,602,941 Y120* probably null Het
Olfr593 C T 7: 103,212,798 R302* probably null Het
Olfr645 A G 7: 104,084,133 *316R probably null Het
Pla2g4e T C 2: 120,189,504 D155G probably damaging Het
Plxnb1 C T 9: 109,108,459 T1176I probably damaging Het
Polg A G 7: 79,465,225 probably benign Het
Prl8a2 G A 13: 27,350,133 probably null Het
Prmt7 G A 8: 106,248,359 R529Q probably benign Het
Psg17 T A 7: 18,820,201 L41F probably benign Het
Rad18 T C 6: 112,686,765 R73G probably benign Het
Rhpn2 G T 7: 35,381,565 probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sarm1 A G 11: 78,497,439 F7S probably benign Het
Sgip1 T A 4: 102,921,477 probably benign Het
Sh3gl2 A G 4: 85,376,449 K99R probably benign Het
Sorbs1 G A 19: 40,321,890 T1018I probably damaging Het
Spns2 G A 11: 72,489,479 A106V possibly damaging Het
Stab1 A G 14: 31,143,476 probably benign Het
Steap3 T C 1: 120,241,880 D191G probably damaging Het
Stxbp5 T C 10: 9,798,275 probably null Het
Sycp2 A T 2: 178,392,398 probably null Het
Tm6sf1 A G 7: 81,859,452 S2G possibly damaging Het
Usp24 T A 4: 106,407,033 D1720E probably benign Het
Vmn1r200 G A 13: 22,395,287 E78K possibly damaging Het
Vmn2r120 A G 17: 57,536,703 L47P probably damaging Het
Vmn2r14 T C 5: 109,217,576 N544S probably damaging Het
Vwa1 C T 4: 155,770,895 A254T probably benign Het
Zfp7 G A 15: 76,891,222 R488Q probably damaging Het
Zfp940 A T 7: 29,845,600 L294H probably damaging Het
Other mutations in Ap1m2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01811:Ap1m2 APN 9 21299304 missense probably benign 0.01
IGL02320:Ap1m2 APN 9 21299324 nonsense probably null
IGL02533:Ap1m2 APN 9 21296501 missense probably damaging 1.00
IGL02806:Ap1m2 APN 9 21305683 missense probably damaging 1.00
PIT1430001:Ap1m2 UTSW 9 21298252 missense probably damaging 0.98
R0172:Ap1m2 UTSW 9 21298332 splice site probably null
R0498:Ap1m2 UTSW 9 21295833 makesense probably null
R1272:Ap1m2 UTSW 9 21305710 missense possibly damaging 0.85
R1424:Ap1m2 UTSW 9 21298204 missense possibly damaging 0.95
R1747:Ap1m2 UTSW 9 21305686 missense probably damaging 1.00
R4477:Ap1m2 UTSW 9 21298213 missense probably benign 0.31
R4478:Ap1m2 UTSW 9 21298213 missense probably benign 0.31
R4573:Ap1m2 UTSW 9 21305758 missense probably damaging 1.00
R4702:Ap1m2 UTSW 9 21298295 missense probably benign 0.24
R4860:Ap1m2 UTSW 9 21309674 missense probably benign
R4860:Ap1m2 UTSW 9 21309674 missense probably benign
R6131:Ap1m2 UTSW 9 21296501 missense probably damaging 1.00
R6191:Ap1m2 UTSW 9 21299305 missense probably benign 0.02
R7262:Ap1m2 UTSW 9 21302466 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CCCAGGACATGATGCATAGGAC -3'
(R):5'- TAGTCCAGGCACACAGTAGG -3'

Sequencing Primer
(F):5'- GGACATGATGCATAGGACTCACC -3'
(R):5'- TGAGGGCATCACCAGCTTAC -3'
Posted On2016-07-22