Incidental Mutation 'R5285:Avil'
ID 403002
Institutional Source Beutler Lab
Gene Symbol Avil
Ensembl Gene ENSMUSG00000025432
Gene Name advillin
Synonyms DOC6
MMRRC Submission 042869-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock # R5285 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 127000709-127020994 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 127018459 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 765 (L765P)
Ref Sequence ENSEMBL: ENSMUSP00000123405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026500] [ENSMUST00000040560] [ENSMUST00000129173] [ENSMUST00000152054]
AlphaFold O88398
Predicted Effect probably damaging
Transcript: ENSMUST00000026500
AA Change: L765P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026500
Gene: ENSMUSG00000025432
AA Change: L765P

DomainStartEndE-ValueType
GEL 14 111 9.44e-24 SMART
GEL 132 226 8.89e-20 SMART
GEL 253 346 1.19e-29 SMART
GEL 395 492 2.07e-29 SMART
GEL 512 598 4.01e-27 SMART
GEL 617 711 2.81e-31 SMART
VHP 784 819 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040560
SMART Domains Protein: ENSMUSP00000042134
Gene: ENSMUSG00000040521

DomainStartEndE-ValueType
low complexity region 38 52 N/A INTRINSIC
Pfam:EF_TS 115 273 9.6e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129173
AA Change: L765P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123405
Gene: ENSMUSG00000025432
AA Change: L765P

DomainStartEndE-ValueType
GEL 14 111 9.44e-24 SMART
GEL 132 226 8.89e-20 SMART
GEL 253 346 1.19e-29 SMART
GEL 395 492 2.07e-29 SMART
GEL 512 598 4.01e-27 SMART
GEL 617 711 2.81e-31 SMART
VHP 784 819 1.31e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140564
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145476
Predicted Effect probably benign
Transcript: ENSMUST00000152054
SMART Domains Protein: ENSMUSP00000122669
Gene: ENSMUSG00000040521

DomainStartEndE-ValueType
Pfam:UBA 44 81 1.2e-10 PFAM
SCOP:d1efub4 101 120 5e-4 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the gelsolin/villin family of actin regulatory proteins. This protein has structural similarity to villin. It binds actin and may play a role in the development of neuronal cells that form ganglia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes null mice show partial embryonic lethality before E10.5, but surviving mice are fertile and exhibit no abnormal behavior into adult. The regenerative axon growth and remodeling of sensory nerves are abnormal in homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,708,465 T12A probably benign Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Adcy8 G T 15: 64,767,857 H685N possibly damaging Het
Aldh1l1 A T 6: 90,576,770 K539* probably null Het
Ap1m2 G T 9: 21,305,637 Y134* probably null Het
Apobr A G 7: 126,585,003 probably benign Het
Atl1 A G 12: 69,954,499 K345R probably benign Het
Caps2 T A 10: 112,208,311 Y472N probably benign Het
Cd177 A T 7: 24,746,249 S590T probably benign Het
Cep295 T C 9: 15,322,591 D2223G probably benign Het
Cfh T C 1: 140,100,898 T493A probably benign Het
Chek1 T C 9: 36,714,452 D299G probably benign Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Crhr1 A T 11: 104,170,497 I243F possibly damaging Het
Cyp3a11 A G 5: 145,855,083 V500A probably benign Het
Dcdc5 A T 2: 106,368,155 noncoding transcript Het
Ergic3 A G 2: 156,018,037 probably benign Het
Fabp3-ps1 T G 10: 86,732,202 probably benign Het
Gm16432 A G 1: 178,103,888 K458E unknown Het
Gm6445 C A 19: 9,607,668 noncoding transcript Het
Gucy2d C A 7: 98,458,267 probably null Het
Ighv1-19-1 C A 12: 114,704,252 probably benign Het
Igkv2-116 G T 6: 68,152,479 R75L probably benign Het
Inhbc C A 10: 127,357,400 R249L probably damaging Het
Lrrn2 T A 1: 132,939,245 S683T possibly damaging Het
Lyst T C 13: 13,634,426 V227A probably benign Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Msh4 T C 3: 153,873,713 N587S probably benign Het
Mug1 G A 6: 121,841,107 E126K probably benign Het
Nav2 T C 7: 49,548,234 S1204P probably damaging Het
Ncor1 A G 11: 62,392,649 I413T probably damaging Het
Nipa2 A T 7: 55,933,012 Y328* probably null Het
Olfr178 A T 16: 58,890,108 Y37* probably null Het
Olfr195 T C 16: 59,149,270 L140P probably damaging Het
Olfr384 T A 11: 73,602,941 Y120* probably null Het
Olfr593 C T 7: 103,212,798 R302* probably null Het
Olfr645 A G 7: 104,084,133 *316R probably null Het
Pla2g4e T C 2: 120,189,504 D155G probably damaging Het
Plxnb1 C T 9: 109,108,459 T1176I probably damaging Het
Polg A G 7: 79,465,225 probably benign Het
Prl8a2 G A 13: 27,350,133 probably null Het
Prmt7 G A 8: 106,248,359 R529Q probably benign Het
Psg17 T A 7: 18,820,201 L41F probably benign Het
Rad18 T C 6: 112,686,765 R73G probably benign Het
Rhpn2 G T 7: 35,381,565 probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sarm1 A G 11: 78,497,439 F7S probably benign Het
Sgip1 T A 4: 102,921,477 probably benign Het
Sh3gl2 A G 4: 85,376,449 K99R probably benign Het
Sorbs1 G A 19: 40,321,890 T1018I probably damaging Het
Spns2 G A 11: 72,489,479 A106V possibly damaging Het
Stab1 A G 14: 31,143,476 probably benign Het
Steap3 T C 1: 120,241,880 D191G probably damaging Het
Stxbp5 T C 10: 9,798,275 probably null Het
Sycp2 A T 2: 178,392,398 probably null Het
Tm6sf1 A G 7: 81,859,452 S2G possibly damaging Het
Usp24 T A 4: 106,407,033 D1720E probably benign Het
Vmn1r200 G A 13: 22,395,287 E78K possibly damaging Het
Vmn2r120 A G 17: 57,536,703 L47P probably damaging Het
Vmn2r14 T C 5: 109,217,576 N544S probably damaging Het
Vwa1 C T 4: 155,770,895 A254T probably benign Het
Zfp7 G A 15: 76,891,222 R488Q probably damaging Het
Zfp940 A T 7: 29,845,600 L294H probably damaging Het
Other mutations in Avil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Avil APN 10 127017034 critical splice donor site probably null
IGL01893:Avil APN 10 127020546 missense possibly damaging 0.73
IGL02127:Avil APN 10 127011826 missense probably benign 0.13
IGL02425:Avil APN 10 127018447 missense probably benign
IGL02458:Avil APN 10 127016353 missense probably benign 0.00
IGL02707:Avil APN 10 127006562 missense probably damaging 1.00
IGL02805:Avil APN 10 127007617 missense possibly damaging 0.79
IGL02836:Avil APN 10 127008995 missense probably damaging 1.00
IGL02961:Avil APN 10 127008306 missense probably benign 0.00
IGL03025:Avil APN 10 127013577 missense probably benign 0.19
IGL03083:Avil APN 10 127016324 missense probably benign 0.31
IGL03345:Avil APN 10 127008957 unclassified probably benign
IGL03365:Avil APN 10 127010983 missense probably damaging 1.00
R0109:Avil UTSW 10 127013644 missense probably benign
R0109:Avil UTSW 10 127013644 missense probably benign
R1159:Avil UTSW 10 127011790 missense possibly damaging 0.94
R1631:Avil UTSW 10 127010625 splice site probably null
R2026:Avil UTSW 10 127011873 missense probably damaging 1.00
R3694:Avil UTSW 10 127008330 missense probably damaging 0.98
R3948:Avil UTSW 10 127014205 missense probably benign 0.00
R4165:Avil UTSW 10 127006627 nonsense probably null
R4978:Avil UTSW 10 127018396 missense probably benign 0.09
R5159:Avil UTSW 10 127020448 critical splice acceptor site probably null
R5254:Avil UTSW 10 127011761 missense probably benign 0.01
R5618:Avil UTSW 10 127010577 missense possibly damaging 0.79
R5682:Avil UTSW 10 127014104 missense probably damaging 1.00
R5786:Avil UTSW 10 127016499 critical splice donor site probably null
R5819:Avil UTSW 10 127009998 missense probably damaging 1.00
R6149:Avil UTSW 10 127006582 missense probably benign 0.25
R6631:Avil UTSW 10 127007749 missense possibly damaging 0.52
R6665:Avil UTSW 10 127020525 missense probably damaging 1.00
R6745:Avil UTSW 10 127014119 missense probably benign 0.00
R6804:Avil UTSW 10 127008306 nonsense probably null
R6838:Avil UTSW 10 127013562 missense probably benign
R7481:Avil UTSW 10 127007591 missense probably benign 0.33
R8213:Avil UTSW 10 127008321 missense probably damaging 0.97
R8349:Avil UTSW 10 127009992 missense probably benign 0.00
R8449:Avil UTSW 10 127009992 missense probably benign 0.00
R8510:Avil UTSW 10 127009781 missense probably benign 0.03
R8849:Avil UTSW 10 127008792 missense possibly damaging 0.91
R8944:Avil UTSW 10 127010586 missense probably damaging 1.00
R9101:Avil UTSW 10 127017004 missense probably benign 0.06
R9176:Avil UTSW 10 127016379 missense probably damaging 1.00
R9733:Avil UTSW 10 127007842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTTTGTCAGGCATCCAGG -3'
(R):5'- AGTTCCTGCAGCATGTTGG -3'

Sequencing Primer
(F):5'- GGACCACCGTTCTGAAAGATGTTC -3'
(R):5'- GCAGCATGTTGGATCTGCTCC -3'
Posted On 2016-07-22