Incidental Mutation 'R5285:Crhr1'
ID403008
Institutional Source Beutler Lab
Gene Symbol Crhr1
Ensembl Gene ENSMUSG00000018634
Gene Namecorticotropin releasing hormone receptor 1
SynonymsCRF 1 receptor, CRFR1, CRF-R1alpha
MMRRC Submission 042869-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5285 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location104132855-104175523 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104170497 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 243 (I243F)
Ref Sequence ENSEMBL: ENSMUSP00000091455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093925]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093925
AA Change: I243F

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091455
Gene: ENSMUSG00000018634
AA Change: I243F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
HormR 40 111 5.59e-26 SMART
Pfam:7tm_2 116 359 7.2e-81 PFAM
Meta Mutation Damage Score 0.7913 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: The protein encoded by this gene is a G-protein coupled receptor that binds corticotropin-releasing factor (CRH) and urocortin (UCN) with high affinity. The encoded protein upregulates adenylate cyclase activity and intracellular cAMP levels. This protein is essential for the activation of signal transduction pathways that regulate diverse physiological processes including stress, reproduction, immune response, and obesity. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit agenesis of the adrenal zona fasciculata, low adrenocorticotropic hormone production, and reduced anxiety-related behaviors. Progeny of homozygote matings die from lung dysplasia within 48 hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,708,465 T12A probably benign Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Adcy8 G T 15: 64,767,857 H685N possibly damaging Het
Aldh1l1 A T 6: 90,576,770 K539* probably null Het
Ap1m2 G T 9: 21,305,637 Y134* probably null Het
Apobr A G 7: 126,585,003 probably benign Het
Atl1 A G 12: 69,954,499 K345R probably benign Het
Avil T C 10: 127,018,459 L765P probably damaging Het
Caps2 T A 10: 112,208,311 Y472N probably benign Het
Cd177 A T 7: 24,746,249 S590T probably benign Het
Cep295 T C 9: 15,322,591 D2223G probably benign Het
Cfh T C 1: 140,100,898 T493A probably benign Het
Chek1 T C 9: 36,714,452 D299G probably benign Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Cyp3a11 A G 5: 145,855,083 V500A probably benign Het
Dcdc5 A T 2: 106,368,155 noncoding transcript Het
Ergic3 A G 2: 156,018,037 probably benign Het
Fabp3-ps1 T G 10: 86,732,202 probably benign Het
Gm16432 A G 1: 178,103,888 K458E unknown Het
Gm6445 C A 19: 9,607,668 noncoding transcript Het
Gucy2d C A 7: 98,458,267 probably null Het
Ighv1-19-1 C A 12: 114,704,252 probably benign Het
Igkv2-116 G T 6: 68,152,479 R75L probably benign Het
Inhbc C A 10: 127,357,400 R249L probably damaging Het
Lrrn2 T A 1: 132,939,245 S683T possibly damaging Het
Lyst T C 13: 13,634,426 V227A probably benign Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Msh4 T C 3: 153,873,713 N587S probably benign Het
Mug1 G A 6: 121,841,107 E126K probably benign Het
Nav2 T C 7: 49,548,234 S1204P probably damaging Het
Ncor1 A G 11: 62,392,649 I413T probably damaging Het
Nipa2 A T 7: 55,933,012 Y328* probably null Het
Olfr178 A T 16: 58,890,108 Y37* probably null Het
Olfr195 T C 16: 59,149,270 L140P probably damaging Het
Olfr384 T A 11: 73,602,941 Y120* probably null Het
Olfr593 C T 7: 103,212,798 R302* probably null Het
Olfr645 A G 7: 104,084,133 *316R probably null Het
Pla2g4e T C 2: 120,189,504 D155G probably damaging Het
Plxnb1 C T 9: 109,108,459 T1176I probably damaging Het
Polg A G 7: 79,465,225 probably benign Het
Prl8a2 G A 13: 27,350,133 probably null Het
Prmt7 G A 8: 106,248,359 R529Q probably benign Het
Psg17 T A 7: 18,820,201 L41F probably benign Het
Rad18 T C 6: 112,686,765 R73G probably benign Het
Rhpn2 G T 7: 35,381,565 probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sarm1 A G 11: 78,497,439 F7S probably benign Het
Sgip1 T A 4: 102,921,477 probably benign Het
Sh3gl2 A G 4: 85,376,449 K99R probably benign Het
Sorbs1 G A 19: 40,321,890 T1018I probably damaging Het
Spns2 G A 11: 72,489,479 A106V possibly damaging Het
Stab1 A G 14: 31,143,476 probably benign Het
Steap3 T C 1: 120,241,880 D191G probably damaging Het
Stxbp5 T C 10: 9,798,275 probably null Het
Sycp2 A T 2: 178,392,398 probably null Het
Tm6sf1 A G 7: 81,859,452 S2G possibly damaging Het
Usp24 T A 4: 106,407,033 D1720E probably benign Het
Vmn1r200 G A 13: 22,395,287 E78K possibly damaging Het
Vmn2r120 A G 17: 57,536,703 L47P probably damaging Het
Vmn2r14 T C 5: 109,217,576 N544S probably damaging Het
Vwa1 C T 4: 155,770,895 A254T probably benign Het
Zfp7 G A 15: 76,891,222 R488Q probably damaging Het
Zfp940 A T 7: 29,845,600 L294H probably damaging Het
Other mutations in Crhr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02156:Crhr1 APN 11 104163883 missense probably benign
R0764:Crhr1 UTSW 11 104159326 missense probably damaging 0.99
R1386:Crhr1 UTSW 11 104174394 missense possibly damaging 0.86
R1812:Crhr1 UTSW 11 104169147 missense probably damaging 1.00
R1822:Crhr1 UTSW 11 104133072 start codon destroyed probably benign
R1903:Crhr1 UTSW 11 104169849 missense probably damaging 1.00
R3427:Crhr1 UTSW 11 104173593 critical splice acceptor site probably null
R3930:Crhr1 UTSW 11 104153551 missense probably benign 0.00
R5537:Crhr1 UTSW 11 104163856 missense possibly damaging 0.94
R6243:Crhr1 UTSW 11 104173914 missense probably damaging 1.00
R6273:Crhr1 UTSW 11 104163856 missense possibly damaging 0.94
R7372:Crhr1 UTSW 11 104163893 splice site probably null
R7664:Crhr1 UTSW 11 104169142 missense probably benign 0.01
X0021:Crhr1 UTSW 11 104169868 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGGATGTTCGTCTGCATCG -3'
(R):5'- AGAATTGAGGCCAGTGCTCTG -3'

Sequencing Primer
(F):5'- TCACTGAGGATGTGGGCCAG -3'
(R):5'- GTGCCTTTGTTGAGGAAGAAGCC -3'
Posted On2016-07-22