Incidental Mutation 'R0416:Ptk6'
ID40301
Institutional Source Beutler Lab
Gene Symbol Ptk6
Ensembl Gene ENSMUSG00000038751
Gene NamePTK6 protein tyrosine kinase 6
SynonymsSik, Tksk
MMRRC Submission 038618-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0416 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181193721-181202789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 181202308 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 66 (Y66C)
Ref Sequence ENSEMBL: ENSMUSP00000016511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016498] [ENSMUST00000016511]
Predicted Effect probably benign
Transcript: ENSMUST00000016498
SMART Domains Protein: ENSMUSP00000016498
Gene: ENSMUSG00000027579

DomainStartEndE-ValueType
SH3 69 126 3.13e-9 SMART
SH2 133 218 5.29e-32 SMART
TyrKc 245 495 2.75e-135 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000016511
AA Change: Y66C

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000016511
Gene: ENSMUSG00000038751
AA Change: Y66C

DomainStartEndE-ValueType
SH3 11 71 2e-16 SMART
SH2 76 161 1.01e-28 SMART
TyrKc 191 441 1.12e-131 SMART
Meta Mutation Damage Score 0.7440 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 91.8%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic nonreceptor protein kinase which may function as an intracellular signal transducer in epithelial tissues. Overexpression of this gene in mammary epithelial cells leads to sensitization of the cells to epidermal growth factor and results in a partially transformed phenotype. Expression of this gene has been detected at low levels in some breast tumors but not in normal breast tissue. The encoded protein has been shown to undergo autophosphorylation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele display increased villus length in the jejunum and ileum and increased villus epithelial cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 A G 7: 119,563,556 I18V probably benign Het
Adamdec1 T G 14: 68,568,712 E438A possibly damaging Het
Adamts17 A G 7: 66,915,898 probably null Het
Ankrd44 T G 1: 54,743,339 I359L possibly damaging Het
Ap2s1 C A 7: 16,747,365 N86K probably damaging Het
Arih1 T A 9: 59,426,710 probably benign Het
Astn1 T A 1: 158,509,891 I389N probably damaging Het
Brca2 T C 5: 150,569,392 S3291P possibly damaging Het
Cacna1d T C 14: 30,100,688 probably benign Het
Ccl7 C A 11: 82,045,866 probably benign Het
Cd74 A T 18: 60,811,414 Y232F possibly damaging Het
Cep128 A G 12: 91,230,867 probably benign Het
Cep89 T A 7: 35,416,402 probably benign Het
Cmya5 T G 13: 93,089,856 N2908T probably benign Het
Coil T C 11: 88,981,986 L391S possibly damaging Het
Cpd C T 11: 76,785,204 V1208I probably benign Het
Ddx19a T C 8: 110,979,057 D254G probably damaging Het
Desi2 T A 1: 178,256,321 probably benign Het
Dnah11 A T 12: 117,911,058 M4024K probably damaging Het
Ergic2 A T 6: 148,183,144 L53H probably damaging Het
Etv2 T C 7: 30,634,633 Y225C probably benign Het
F10 G A 8: 13,055,448 A338T probably damaging Het
Fam228b T A 12: 4,762,382 D132V probably damaging Het
Fat2 T A 11: 55,284,134 I1918F possibly damaging Het
Fbxw5 C T 2: 25,503,239 S214F probably damaging Het
Glyat G A 19: 12,651,453 R204Q possibly damaging Het
Gm4825 T C 15: 85,510,981 noncoding transcript Het
Ino80d G T 1: 63,086,276 T9K possibly damaging Het
Lifr A T 15: 7,166,914 D193V probably damaging Het
Lrp12 G T 15: 39,878,911 probably benign Het
Lrp3 A G 7: 35,202,353 V701A probably benign Het
Mfsd11 T A 11: 116,865,882 probably benign Het
Mrto4 A T 4: 139,349,732 probably null Het
Msi1 T C 5: 115,430,649 F43L possibly damaging Het
Mthfsd T C 8: 121,101,237 D168G probably damaging Het
Myo15 T A 11: 60,511,174 V3099E probably damaging Het
Myrf T C 19: 10,215,812 probably null Het
Nadk C A 4: 155,587,799 probably benign Het
Nav1 T C 1: 135,471,126 K573E possibly damaging Het
Ndufs3 A G 2: 90,898,388 V207A probably damaging Het
Nlrp3 T C 11: 59,555,924 probably benign Het
Nlrx1 T G 9: 44,262,914 D330A probably benign Het
Olfr331 T C 11: 58,502,396 I53M unknown Het
Olfr444 G A 6: 42,955,570 C24Y probably benign Het
Osbpl3 C T 6: 50,348,018 V167I probably benign Het
Pcnx A T 12: 81,974,466 I1410F probably benign Het
Piezo2 G A 18: 63,024,491 R2383C probably damaging Het
Pip5kl1 A T 2: 32,583,424 K358* probably null Het
Polg T C 7: 79,452,240 probably benign Het
Prr14l T A 5: 32,828,717 I1145F probably benign Het
Psmb1 C T 17: 15,494,519 V39I probably benign Het
Robo4 T C 9: 37,404,766 probably benign Het
Sdk2 A G 11: 113,803,203 Y1801H probably damaging Het
Serpinb3a C A 1: 107,049,386 A95S probably benign Het
Setd1a CTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 7: 127,785,297 probably benign Het
Sik2 A T 9: 50,995,632 Y98N probably damaging Het
Slc30a1 C T 1: 191,909,726 P495S probably benign Het
Smg1 A T 7: 118,184,461 probably benign Het
Stk3 T A 15: 35,114,632 I45L probably benign Het
Tapbp A G 17: 33,925,418 T163A probably damaging Het
Tdrd5 T C 1: 156,285,481 K410E probably damaging Het
Trim30b A T 7: 104,363,766 M152K probably benign Het
Trpm6 G T 19: 18,783,025 probably benign Het
Tsc22d1 T C 14: 76,505,303 probably benign Het
U2surp A T 9: 95,485,607 F444I probably damaging Het
Vmn2r95 C T 17: 18,441,402 P470L probably damaging Het
Zc3h4 T G 7: 16,420,275 Y163D probably damaging Het
Zfp62 A T 11: 49,215,676 H198L probably damaging Het
Zmym1 A G 4: 127,058,820 L56P probably benign Het
Other mutations in Ptk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Ptk6 APN 2 181195818 missense probably benign 0.00
IGL01630:Ptk6 APN 2 181197066 missense probably damaging 0.99
IGL01862:Ptk6 APN 2 181199640 missense probably benign 0.00
IGL02231:Ptk6 APN 2 181197001 missense probably damaging 1.00
IGL02965:Ptk6 APN 2 181199068 splice site probably benign
R0115:Ptk6 UTSW 2 181202527 start gained probably benign
R0139:Ptk6 UTSW 2 181196931 splice site probably benign
R0245:Ptk6 UTSW 2 181202491 missense probably benign
R0358:Ptk6 UTSW 2 181198522 missense probably benign 0.01
R0454:Ptk6 UTSW 2 181202282 missense possibly damaging 0.86
R0470:Ptk6 UTSW 2 181195939 missense probably benign
R0481:Ptk6 UTSW 2 181202527 start gained probably benign
R1147:Ptk6 UTSW 2 181195797 missense probably benign 0.23
R1147:Ptk6 UTSW 2 181195797 missense probably benign 0.23
R1234:Ptk6 UTSW 2 181202440 missense possibly damaging 0.94
R2249:Ptk6 UTSW 2 181196380 missense probably benign 0.03
R4842:Ptk6 UTSW 2 181196991 missense possibly damaging 0.89
R5568:Ptk6 UTSW 2 181199695 missense possibly damaging 0.47
R5806:Ptk6 UTSW 2 181199730 missense possibly damaging 0.95
R6017:Ptk6 UTSW 2 181195812 missense probably benign 0.32
R6285:Ptk6 UTSW 2 181197093 missense probably null 1.00
R6293:Ptk6 UTSW 2 181198460 missense probably damaging 1.00
R6468:Ptk6 UTSW 2 181199102 missense probably benign
R7369:Ptk6 UTSW 2 181198461 missense possibly damaging 0.86
X0062:Ptk6 UTSW 2 181202323 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGATCTCGTCCCTCACAGCCAG -3'
(R):5'- TAAGTGTCCACAAGCAGGCCACAG -3'

Sequencing Primer
(F):5'- AATCCACACTGGGCATTTTGG -3'
(R):5'- GCTGACTCTGCCACTAAGC -3'
Posted On2013-05-23